Description :
From Genome Similarity Track
Location :
contig_1:21716- 26678
Transcript NameFunction/comments
g4.t1hypothetical protein
g5.t1hypothetical protein

Sequence
4962 bases(100 bases per row)
GCAGGTTGCCCTGGATCAGCTTGATCGTCCCACCGTCCCCCGTGCTATCTGGATCCCTGGATATTGCGCTCGTTCTCGTAGGGCGGCAGCGGACGTTCGC
CCGTGGTCGGCGAGCACTTTGAGCCGGGTCAGTGTCTTGGAGATGGACATCGAGTTGCTCTTTCATCACCTGGCAAAGCCTAAAAACTGGCTTTTTCCGC
CGCAGAGTCGATCGCCTCGTCACGGTGCTTGGTCACCCGGTCTGATCACCGAAAGCAACATTGCGGCACTTTACGCGACGACGCCGTGGAATTCTCTCAA
CGTCTTGGTGACACCTTTATCTTTTGAGGTGACTGGTTGGTTCGAGGCGATGTCTCGGAAGTATCTGGAAATTGAAGATGATCACCGGCAGGCTCTATGG
GAGGCTACGCACGCGTTCATGATCAGCTCCGCGCTTCGTAAATCGAACACATATCTGGCACGTCTTTGGGAAGATCGCAAGCATAGACGATCACGTTTCG
GTGCCGTCTGGAAACGCTTCCTCAAGTTGATTTTGCAAGGGATGATTGCAGGGCACTGCGACTTGGATATTCTGCTGGACCCTTCTTTCTGCATTATCCC
CGGGCGCACGAACAACGAGTTTGGTACCCTGGGCTTGGTAGCAGCTCTCGCCTCCAACCTGGTGGACGTCCTACGTGCCGTCGATCTGGTTGACCCGTGG
CGCAATCAGTATCGCGGCCACCTTCAAGATCATCCGAGCTCCTAACTGCCCCGCCTCACCGGCAAATTCTCTCCTGTCGCCGACTAAGATGAAGTGGTTA
GTGGATCGTATATCTTCTCAATATGATCCCCACGGCTTCTCCCTTCGTTGTTTTTCTTCATCATTTTCTTGCTTTATCGAGCATCCCGCTCTGATCGAGA
ACAGTCGTCCTCGATCTACACAACAATATCACATAAAAACCCTTCCACCTCAATGTGCGACCACCTCACACATTGTTCACACCACTCCTCCGCCCGCAAC
AGCCAACCTGCTACGAGCTCTCCTCCTCCACCTCGTGCGACTGCATCAGCGAAGCGATTCCGGTTGGTGACTCCTCGCTCGTACTCGCGCAACAAGGCTC
CGCAATTCAGATCGGCTTCATCAACCCACGAAAGCTGATCGTAACCCTTCCAGCGCACCTGAAATTCCCGGTGGACGCGACCATATCGCGTACGTCGACC
TGATCGCATATTCACGATCTTCTCCACCTCGAACTCGTCCTCATCGAGACCGCCTTCCCAGCTGTCTTCGGGTAAAAGTGCCTCATCAAAGTCGAAGCGA
TCGTCTTCGTCCACCACCAGCGTCAGCGTGGGGCGATCGGGGAACGATCGCACAGGCTTGAGTTTTGACACATGGACGATCGGGAATAACCGATAGTTGG
TGCCAGCGACTTCCAACCTTGCTGCATGATTGTCAAGCATCTCGATCACCCTGAACGGTCCGTGCCCCATGTGGGCTAACTTGCGTGCATAGCCTCCTTC
ACGCGATCTAGGTGCAGCCACACTTGCATATTGGCCTCAATCCCATGAGGTCGGACCTGATCGTTATGCCCGTCTGCTCGTCCTTGATGGCCTCCCACAG
GGACTCATTAACCTCTTCTCTGGCTCGACGATAGTGGCTCTGTATATGATATCTCCACCGACGAGGGTCACGATCCCGGCGCGTGCTTCCGAGAGGTAGC
GACGCTTCTAACGTAGATTGCGGTCCCACCCGTGTGTCAAGTAGAACGGCGTATCTCCTCGAACCCGATCTTGGGCCGTGTTGAGCGCGAACGTCAGTCA
CTCCGCGTACTCATCCCAGTCCTGTTGGTTGACGTCTGCGACATACCTCTTCAGCGCACGTGTCAATGTTTGCACCATCCGTTCTGCCGTCCCATTGGCC
TGTGGACGATAAGCCATAGTGGCCCTCTGTTTCTGTCCCACTATCCTGCTAAAAGCACGGAAAAAATCAGACATGAACCCAGGTTCCCTGTCATGCCGGA
TAGCCTCACTGGCTCCAAAACGCCGGAAGACGCATTCCTCGTAGTTCTCCGCAATCGTCTGAGCTGTTCTTGACGCGCTCGCTTTAGCGATCACATAACC
CGAGAACAGGTCTACCCAGATCAACAGCTCCGTATTGCCTTTGAAGGACTTGGGCAACGACGGAATGTGATCCATAGCGATGATCTGAAACGGGTACGTC
GCTTGCACGTTCCCAGGGGATTCTCCTCTCACGAAGGGTCGGCCTTTCCCTGTCTCACAATCTGTACATTCTCCCACATAGCGCTGAACACTTCGGTATA
AGCCCCTCCAGTGGAAGTGTGATCGGATTCGTCGGTACGTCCTTCCGATCCCTTGATGTCCCCTTCCAGACTTGCGTAGTAATGATGTAGGAAATCTTGT
TGCAGGGTCTCAGGCACCACCAGCTTCGCGATCTCTTCACGGTCCTCCTCCTCCTGCATGGCTGACGGGCAATAGAACAGCAGATCGTTTTCGTCCAACT
CGTAATCGTTCGCGACCTTGGCGCACGATTTAGCTTCAGCCGCGGTTAGAGCCTCGACGTTCCCTTTCAGGTATGCTTTCAGATCGATGATCCACTTCTT
TTCGTCTGCGCTTGGATGATTCGTTCACCGCGCATGCGCTGTACAATCGTTTCCTGCAGGACTTCAGGAGTCAGTCGTCTGCGTCGCGTCGATCTGGTCA
CAACAGACACACGGACGACGGCATCGTCGTCCCTCATCTTGAGGAGCTCGTCCAAACGGTTGAGCGTGATCAAGTCTTGTTGATCTTCGTTGAGGTGACT
ACGACCCTTCGCCCGTTGGAGAGCTTCACTGGCTAACTTGTCTGCACTCTGGTTCCAATCTCGTTTCATGTGTAGGAACTCGTGTTTTACCACGACTGAG
TTGATCCATCGCTTCTCTCGCGCAACAACAACAGGCCAGGCTTGCATGCGATCTCACCACGCATTGCCGGATAACTAAATTGGAGTCGCCGCAGATCACA
ATCCGCCCCCTGTCCATCGTGGACAGCAGATCGAAGCATAACAACAACCCGCGGTATTCAGCCTCGTTCACCGTCAGATCGGGCATATACTCCGACGCGG
CGGTGGAGATCGTCCACTCTGGCAACTTCCATATGATCGCACTGTAAGCTCCACCACTGCGTTTGACGCGTGCCGATCCATCGAAGCTCGCGACCAACAA
AGTTTCGTCCGCTCCGATCGTAGGGGGTGGCATGGTAATCGTCTGTCGGGGCTGCTTCACGGGTGCGATCGCGATCAACGCCTCGTCTACTTCCGCTCGA
GGTGTGATGCTTGCTGCCATCGTGCCTAAGATTTCGTCTTCCCCTTTCGTGCACTTCCTGATCTCCAGTGTCCATTCTGATAGCAAGGCTGCCCAGTTGC
CAAGTCTCCCTTGGAGACCGGCCGAATTGACTAACCAAGCCAGCGTCGAATGCCTGGACAGCACCAAGATCGATCTCGTCGTCAACAGGGTGTAGATCAC
GTCCAGCATCCGCAAGGGTGCCAAGAACTTCTTTGTCGACGATCCCGTAATTGATCTCATTCGGTTTCAAGTACGACTGGTGAAGGTTACTGGCCAATAC
ACACCATCATGCTCTTGTACGAGTGCCGCGGAGATCGCCCACTGGCTCGCGTAAACTACGATCACTGGAGTGCGATCTGCGTCGAAATGCTTCAGGATCG
GTGTGGACACGATTTTGGCCTTCAACATTGTGAACGCGATCTTCGCTCGGGCCCAGCGGTCAGCGTCTTCCGCTCGCGGGACATCGCCCCCAGTTACTTG
TTCGCTGGGAATGGATCTGTCCTGTCGGGCAATCTCGTGGAAATCCGCTTCACGCAGTTCGTACAAGACGGCCGCATAGATCGCGAAGTCTTCGATGAAG
CGACTGTAGTAGTTCAAGCTTCCAAGGAAGGACTGCATCGATCGCAGTGTCTGCGGGAAGGGAAGGTTGCCTAACACTTCAAGATCTTTTGGATGGGCTT
CCAAACCGTCGACGGACACTCGGTGTCCCAAGTAGTCCACTTTTCGTCGGCCACAGAAACTTTTGACCACACTGATGGACAAATTCCACCGTTCGCAAGC
ATCGAGTAATGCTTCAACCTTCTCACACAGCAAGTCCCAAGTGATCGCAGTCACCAAAATGTCATCGATGTACGATCGTCTTCCCAACACTGACGGTTTC
GGCTCTAGTTCCGGCTCGCCTGAATTGAACACGTCGATTGGCTTCGACGGATCGTGACCGGCGCGGATTCGGAGATGTCCATACAGCGCGTTATCAATCA
ACCGCTGGTAGATCTGTGGCGCATTCTTCAGCCCGAAAGGCATACGCGTCCACTCGAACAACCCGAATGGCGTGATAAAAGCGGAGATCTTCCGTGCGCC
CTCCGTCATGGAGACTACCCAGAAGCCACTTGCCATATCGAGTAAGCAATACCAGAGCACTTTGTCCAAGTCTTCCAAGAGATCGCTAATCAGCGGCATG
GGGTACATCATCAGTCTCGTCAAACTGTTCACCAGCCTGTAGTCGATACAGAGCCGGATGTCAACGCCGTTCTTCTTGATGATGATTACGATCGGAGAGG
CCCACGGTGAAGTCGACGGCATGATCATCTTCGCCGATAACAGGCTCTTGATCAGATCCGACAGCTTCTCGCGGAATTGTGGAGCGACCTTCCGGACGCG
TTGTACAACAGGAGCCGCTCCTCCCACATCGATGTCGCAGACTGCGCCAACGGCGGCCGGCGGTAGCGCGTTTCCTTTCCCGACCAGAAGATATTTCCGT
CTCCAAATTATCTGTCGCAGCCGATCGATTTCTTCCGGGGTGTTCGACTCTGGATCGCCCACTGGATATCTTCGATCGTAACCTCATCAGTGGCAGTCAC
TACTTCTGGTAGAATTGCCAACTGACGCTCCACATCTTCGGCGAAGAGATCGCCACCTTCGT