Description :
From Genome Similarity Track
Location :
Scaffold_10:217135- 238353
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G004704Similar to AAEL007818: Trypsin 3A1 (Aedes aegypti)
Pytul_DAOMBR144PYU1_G004703Protein of unknown function
Pytul_DAOMBR144PYU1_G004702Similar to manA: Beta-mannanase/endoglucanase A (Caldocellum saccharolyticum)
Pytul_DAOMBR144PYU1_G004701Similar to TPRXL: Putative protein TPRXL (Homo sapiens)
Pytul_DAOMBR144PYU1_G004700Similar to SKP1A: SKP1-like protein 1A (Arabidopsis thaliana)
Pytul_DAOMBR144PYU1_G004699Similar to SLC33A1: Acetyl-coenzyme A transporter 1 (Homo sapiens)
Pytul_DAOMBR144PYU1_G004698Similar to PLEKHF1: Pleckstrin homology domain-containing family F member 1 (Homo sapiens)
Pytul_DAOMBR144PYU1_G004697related to a-glycosyltransferases
Pytul_DAOMBR144PYU1_G004696Similar to Os06g0698300: Probable protein phosphatase 2C 59 (Oryza sativa subsp. japonica)

Sequence
21218 bases(100 bases per row)
TTGGGTTTGCATCAAGTAATCAACGAGGCAATGGCAATATCTCAGCCGACGAGCGGTACACGCGATTCTCGTTCTCTCGTCTGGCATTCGAACATCACGC
CGCGTTTCTCACGATCGCGACCGAGTCGACAATTGCGTGGACCAACGATGACGAATCGCTTGAGTCTCCCGAAGATGCTCCAGCAGGATCGTTCCCTTCG
TTCATCGCCAGTTTCTTTAGTGAGGCGCAGCGCGGACCATTGCGATGTCAGGGAATGCTGATCGCACCGAAGGCTGTACTGACGACCGCATCGTGTGCCC
TGGGAAACGCCATAGTAGAAGCTGTTTTTGTGCTTCCCGACCGGAAACTGATCCACGTACCGATTCTTCCCGATCAAACTATCGTGCACCCGCGTTTCAA
TACAACGAGCTCTCTGTCGCAAGATCTCGATGCCGGTCAGTACGACTTTGCAATCCTACAACTGCAGTTTCCGACAATTATGGCACCAGCCATGCTCAGC
ATCGGCGGATTAAGTGACACTGACGATCCGGTTGGATTTCACTTTATCCCAAAATCGACGAGCTACGAGAACGGGCGGATTGGCGCAGAAAACCTGTTTA
CGCAGACGGCTTTCAATCGATCTACTAAATGCTCAGCGGCCAAGACGGCAGCCAACAGCTCGTCATCGTCGCTGCTGGTCCGGCAGTCGACTTCCTTTTG
CCTCACGCCATGCCAAACGACCACTCCAGAGGATGATAATAGCATCACGTTTCCACCAAAAGGCAAAACCAGCAGCAAAGAAGTGCCTCCCTTGTTTCCA
CCTAGCGATGGCGACGACGAAGTGCCTCCGGTCGACCCTAGGCCTTCATTTATGGGATCAGCGTTCGGGAAACAACTGAACAACACGTACTCGCTCGTAG
GCTTTGGTGTCACGCACGAGGTCGACGATGGGGACATCTACTCGGTCTCGAGTCTTGCTGATGCTGCAGTGTTCATCAATGCCTACGTCGCAGGTACGTC
CTGGGAAGCCGGTGGTGTGCTCGTCGACGGTCCGTTGCAGCTCTCCAAGCGGTACATTGTTGGATTACGGGTCTCAAAGTACGGTCAAAACTTCTGTGGC
GGCAGTCTGATCGCGCCGAGCTACGTGCTCACGGCGGCGCATTGCGTAACCGACGGACTCGCCAAGTACGTTTCCATCGGCTCGAAGGCCTCGAGTGGCG
AGGAAACCGAAGCCATTGGCGTTGTCCAAGAGTCCATTGTCGTCCACCAGAGCTACGGCACCCCATACAAGTTTTCTTACGATGCGGCGATCCTCGAACT
GAAGGCGTCGGCATACGCGACGCCTGTGGTGCTGGACAGGTCCCCCGATTTCTCAAGCGGCGAGGAGGCGAGGATGTATGGTTACGGAGCCACCATCCAC
GGGTCGAGTACTAGTGAAAGCACCCTCTCGCCAGAGATTCGCGCTGTGGACCTGTCGCTGTTGTCCCAGGCGCAATGCAAGGCGACGCTACCAGATATCG
ACAAGAGCATGCTGTGTGCGGTCGGGAAAAACGGTGACGATGCGTGTAAAGGCGACTCGGGCGGGCCGTTGGTCGTGCTGCCCAAGTCAGTCAACAGCAA
TGGAGACGTGCTCGTGGGAGTCGTGAGTTCAGGATACGAGTGCGGTCTGAAAGACGTCCCAGGGATCTACATGCGCGTGAGTTCGCTCTCGAGTTTCATC
GAAGACCACACTGTCGGCGCTGAGTGGGGGCGTCCGGTCACTCAACTACCCACACCGAGTAGCACTTTGACACCGACGGTAACTCCTTCGACAGATGCGG
AAATGCGAGATTTGGACAACTTGTCACCCCGCGAATCAGCGTCAGTAGATGGGAGTAACGCGACGAGTCGAAGTGACGAGCTTGGTTCGGTCTCGGAACA
TCGATCCCCGATTCAATATGTCGATGTGCCAACCGATTTGAAGCCGCAGGTCCGGCACGCGCTACTGACTTATCTACTCGGAATTTCCGAGTCGCTCGTT
GTTTCGTCCGCGTTTCTCGCGAAACTGACCTCGGGCACGAACTGGATTCGATTCTATTCGTCGGGGGATTTGTCGCCGATTCTAGAGACCCTCAAGCATC
ACAATAGCAAGCCTCTCTACGCTCGAAAAGACCGCTTCGGACGATACAAAAGCGATGCCTCGACGCTGGACGGCAATGCCAGCAGCTCACTCAATCAGTG
TAAATCGTGATCCACCAAGAAGAGCGGTATGAAGATTATAGTATGTTTATTGCGTCCCTTGCGGTGTCAAGGCGGGCAAAGTCGACGTGAAATATAAGCA
AAAGTCAGCTTTCTTACATTCGAAGCCTGGCAACTGAGCTCCTACTGCGAGACCCATCAGACAAGAGGAAAATACCCAAAAAAACTGTGAGCGTGCTTGA
TCTAAGGCGACTTTGCCTTTAGTCGCAGACTTCCTTGTCGCCGCGACCGAAGTTTTGCGTCCAGTAGCGTTTATACTTGCTGTTGACATTGTAGCCGTAT
CCCATGCCGAAGAACGTGTACGTGCCCAGGATGTTCGCGCGATGACCAGGGGAGGTCATCCAGGCTGCCACAACAGCCGCGACGTCGACTTGACCTGCGG
CGACGTTCTCCGCGATGCCGCTCCAGATGAAACCCTGTGCGGTGATGCGCTGGCTCATTTTAGACCCATTGGAGCCTGTGTGACCCATGAAATTGTTAGC
GGCCTGGTCGTCCGAGTGCAGTTGGGCTGCTGCCTGGAGCTTCTTATTCGTGCAGAGCGCGGATAGTCCGACCTTGATGCGCTCGGCATTGACAGCGTTG
AGCATTTGCACTTGCATGCTCATTGGTCTCGCGGTTGTTGGCGCAGGAGTGGTTGGCTTTGGCGTCACTGGAGCTGCCGTCGTTGGCGCAGGCGTGACTA
CAGTGTCGGTGTCACACACTTCGCTGCTGCTGGCGCCGAAATCCTGGGTCCAGTAGTGCTTGTAGGTTGACTGAGCGTTGTATGCGTACCCGGTGCCGAA
GAATTTGTAGTTGCCCAGGATGTTCGCGCGATGGCCAGGGGAGGTCATCCAGGCTGCCACAACAGTCGCGACGTCGACCTGGCCCGCGGCGACGTTTTCT
GCGATCGAGCTCCAGACGAAACTCTGTGCTGTGATGCGCTGACTCATCTTGGATCCGTTCGATCCGGTGTGGCTCATGAAGTTGTTCTTGGCCTGGTCAT
CCGAGTGCAATTGGGCAGCCGCCTGGAGTTTCTTGCTGGTGCAAAACGGTGTCAACCCCTGCTTGGCACGCTCGGCGTTCACTGCGGCGAGCATCTGCGC
CTGGTACTTATCGGTTGCCGAGTACGTCTGCAAGTCGCGATCGACGAATTGCTGCTGAGAGACTTTGGCAACGACAACACCGAGTCCATCTTCCATGAGT
GCAGCCGCACATGATGCGACGACGATCAAGAGTCTCCACGGAAGAATGGAAGGCATCGCTTGTCTTAATGCACGATTACACGCTTCCTTTGAAGACCTCG
CAGTGGCTTGATGAGAAGAGGAAGCTTTTGGTTGTGGGCTTGAGTGCAGCGTGCATGATCGACAGAATAGCTCCTCCTTCCCATTCCCATGATCCCCAAA
ACGTAGTAGGTGAGTTGAAGGAACGTTCGCTACTTCCTATAGCGTGGCCGGTGTGCGCCGAGCATGCACGTGAATCGGACAAAAATGACAAAGTTAGCAT
CGAGAATCCCATGAAACACAGCATTGTCGCATACCAAACACCAAATGCAGCTATCGGTTTTCTGGACCCATTTCCATATTAATAGCTGACTTTTGATCGA
GCTATCAAGCGCAAAGTGTAGGTTTGTGATGATCATCGATCTATTTCACTATCGGCAACGTTCCACGAACTGTGGGGTCAATGGACAGCCTTTAAACCAG
CCCCGAGTTTGACCATTTCCCCCCAAATGCTGGGATCTCCAATTCACTCGACTCCCTCGGAATAGCTGTGCACTATAGTGTCGCTCTCGAACTATAGCTC
TATCCCATGAGAAGATCAAATGACACATGAGCCAAGTGAAAAGCGCAAACGATTTCTCACTATAGATACTGCTATTATATTGATTTAGCTTACTCCTTCG
TCATATACTTTTGACTAACAAACATGGACACCAAGTGATATACATATACAAGCACATGGACAGATCTACCCTGCGTGGCTTCTTTTATTCACAAGCTTCG
CTGGAGCCCGTGCCGAAGTCCTGGGTCCAGTAGTGCTTGTAGTTACTGTTGGCGTTGTACGCGTAGCCCATGCCAAAGAACTTGTAGTTGCCCAGGATGT
TGGCCTTGTGGCCGCTCGAGTTCATCCAGGACTTCACGACAGCAGCCACATCGACCTGACCGGCGGCGACGTTTTCTGCGATCGAACTCCAGACGAAACT
CTGTGCGGTGATGCGCTGACTCATGGTCGATCCGTTCGATCCGGTGTGGCTCATGAAGTTGTTCTTGGCCTGGTCTTCCGAGTGCAACTGCGCAGAGGTC
TGCAGCTTCTTGTTGGTGCAGTAAGCAGCGAGTCCGACCTTGGCGCGCTCAGCGTTCACGGCGGCCAGCATCTGCTGTTGCATGGTCTGCCCGGTGGAAA
TTGGCGTCTTGGTCGTTGGCGTTGGAGTCGTCGTCTGCTGCACCGCAGGAGTAGCAGTCGTTGCCTTCGGCGTCATCGTTGGAGTGGCCGTCGTTGGTGT
CGGAGTCACTGTTGGTGCGGTGGTGCTCTGGACAGTTCCGCTGCTGTCACAGGCTTCGCTTGACCCGGTGCCAAAGTCTTGGGTCCAGTAGTGCTTGTAG
TTGCTGTTGGCATTGTACGCGTACCCAGTCCCGAAGAACTTGTAGTTGCCCAGGATGTTGGCCTTGTGGCCGCTCGAGTTCATCCAGGCTTTCATCACCG
CAGTGACATCGACTTGACCCGCAGCCACGTTCTCAGCGATCGAGCTCCAGACGAAACTCTGTGCGGTGATGCGCTGACTCATGGAGGAGCCGTCGGATCC
CGTGTGGCTCATAAAATTGTTCCTGGCCTGGTCGTTCGAGTGCAACTGCGCAGACGCCTGCAGCTTCTTGTTGGTGCAGAATGCAACGAGCCCGACTTTG
GCGCGCTCGGCGTTGACCGCGGCGAGCATCTGCGCCTGGAAGTTGTCGCTCGACGTGTACGTCTGCAGGTCGCGCTCCACGTGTTGAGGCGACGCGGAGA
CCACAGCCTCCAAGGACGCGATGCTAGTGCCCGTGACCAGCGCCAGTGTCGTGGCGACGAGGAAGAATGCTCTGGAAATGGACGAGTGCATGCTGTTTGC
TATGGCCCTTGGCTTTACTTTGGCTTTGCTGTGCGCAAGACTGGGCAAATTGGAAAATGAGTGAGTGACAAGATTGGAGCTCTTCACGATCCAAAAGGCT
CAGAGAGCTCCGGTGCAACGAGATCTTGCAGAATGCTGCGTCTCCTTTCCGGACTTGAGACTTTGGTCCTTGCGTCACTCTCGAGCTGACACTTGACGCC
GAGCAACGTTCCCCATGACCAGCTTGCTTTGTGGCATGCTTCAGGATGTTGTGGACAAATTTTATATCCGCATTTTTGTAAAACTACGCAACTATTTCAT
AATTGCTACAACTATATTGTCCTTGCTTGTGAGTTATATCCGTACGGCATGGATGCCTTGGATATCGCCCAGCTGGTCCAGTTGGTTCAAGAAAACGGCC
ACTTTGTCCGCCAGCAGCTCCGTTGCTCAAACTATGCAAGGTAGCGTCGGATCTGCAGGAGTGGGCTGGTCTCTGCTGGGCGTATGCGAGCGATTACGCT
TGAGATGCTGTCATGTCCACACGCAAACACCTCCGCAAGTCCACTTGATCGATGTGACCTGGACTTGCAGGCTCCAGATCCAAAGTAGCCTGACAACTGC
ACATTATCTATCACTCTGTGAGCTATGTGCATGGGAAGGTGATGTCTGGTAGATAGATACGAGTCCAGCATGCGAAGAACTTTGTTCCTTTGAGGTTTAT
AAGGCGCAGCGCACTCATCAGCCCATGGCGTTGAGGACAACAGGGTTGGTCCGCTCATGTCACCCCCATGAGCTGGTGAAGTTTGAAGGTACCACAGTGG
GATAGTAAGCTCAGTAAATTCCCTCGATTGGGCGATAGGATAGTATACTCGATCGCTCATAATATCCATTTTAACAGGAATTTATGATTTGTTACTATAT
CAAGTATGGAAACAAATAATTGATAAATGGGTAAAATATACATTGTCCAAGGAGTATCTGTTAAGGAGATAGTCAGCATTAATCCTGTCACGGTTGTTAA
CAACGAACAAGCACCATCAACACAACGCGACGATTTTCACCACCACCACCACACATGCTGACTGGTATTAAATCTGCCAGATCAACGATACGTATAAGCA
CGCCACAATATTCACATTGCTATGTAAAGAGCAGTCCATTCATACATACGCTGCTGCAAACTGATGTTGTGCTGCCTGGCGCAAGGGGTTTGACAATCTT
CACACCATGGAAAGGACAGGCGGCGCTGGAGAGTCGTTGCCTTGTTGGGACTGGCGCGCGTTGTGAACCCACTGCCATGTTGCGAGCCGAGAGAAAAAGA
ACAACAGAGTGAGCTTGTGGAGCGGCGGGCATGAGCGAGCCAGTGGTGCTCGCAACCATTCTGCAGTGCACACAGTCCGCCGAAGCAACAAGAATGGCTT
CTGACTAGTGCGTCCGTATCAGCGCAGGTCTGAGTGCCTTTGCTGCAAACAGTCTTCCAAGTACCGATGCAACCTTCACTCACAGTACCGAGGATTGTGG
ACAGACGCACAATATTGTCCTCGTTCACAACACCTAAAGTTTGCAAGTTGGTTGCTGCGATTTCTATCCAGGTGCCCTTATTTGGGTTCTGTATGTATTT
GTCATGCAAGCTCGAGTCCGCCCTAGTGCTGAGTACGCTCAAGAGCGTCAAGGCTTCGCCCAGAATTTGTTCGGACTATCATGCTACTGCACTGGTGCTT
TGGCAGGGGGAGCAGCATTGGACTCACACTGAAAACGACGGCAGCATTCGTATCCATTCGAGCACGATTCATTCCGTTAGAATGCGCCTCATGAAACCCA
CGTTTCACAACCACACACACAGAAAGAGACTGGAAACGCCGGCAACTGTCTATCACATACTGGATGCATAAGAAAACAGAATCAATGGCGCCCAGTCGCT
TTCATAACGACTTGGGCGTTGTATCATAAGACGAAGAGTGCAACCTGAGCATGCAGCAGTTTGTTGAACTGTCAGAACGTTCCAACGCAAGAAATCGTGG
TGGAAGAAGCGGCAAAGCGACCGCGAACGTTGAGCGAGCTGAGGATGCACGAGTGTAACGATCTTGCCGCACGTGCGACCTCAGACCCAGCTGGTTGCGA
GGCAAATGTCCCTCTTCAGCCATGCAGCAATAGCGCTGAGTGGCTCTAACGGCGCTCCATACATGCTGCCCACATGTGGCAGCGTGGAAGCGAAACCTGT
TGCTGCTGAGAAGCCCAAGGGGGAGATTTGTTGGCTTCTTGGTGTTATTTTCGCGAGTTCCGATGGATAATGCAAGCAAGTAGAGGTTTGTAACGCGTGT
GTGCTCCAACGCATGTGTGTATTCCTCTTTCGCCACGTTGACTGGAAATACGTAGGTCGCTAGGTAGGCTTGATAGGTAGATTAGCACCTAAGCGATCGA
CGGATGTTCCAGTGGGCTGAGGTGCTACGGAGGTGACTCGTATCGCTACTTTGTGTGGTGCTTCTGCTTTGCGCGCGCATGCTAATTGTCCTCGCGGCAG
ATGACAGCATCACTGGGCAACTCTGAGTTGCGGCAACGGTAAACTGAGTTCAGATTTCTGTTTTGGTTGGTTTCGACCTTGCATAATCAGTATATCGTGA
TTATTGCATGAATACTATATTTTACTAGGTGTTCAAACTATTGACATGTATGTATATGTAGAATAAAAGGGGTATTCTATATATACAGCTGGATATAAAA
CACACTTTGTCTGCCACTCCAACTGTTTCCTNNNNNNNNNNNNNNNNNNNNGGATATCATCTAATAGATGGTTTTGAATTCCATAGTTCATCTTTAGCAT
TCAATAGCACATCAAACCACTTTTGACAGAATCGGAGCGTGCCACAAGACTGTCTCTTTCCCATGGTCGACGCGCGCGAAAGCTGTTAATTCAGCGAAAC
CAGCTGGTGTTGAAGCGCATTCCGCGTGTGGATAGGGAGCAGGCGCGCTCTGGAAAAGACGAGGCCGCGCTGTGCCCCTTTAGCATGCTCGGCTAATTAC
CATGGCAGCATGCTTTTACTGCTAATCATTCCGCAATTTGCCTTCTTCGGCCCACTCCCACCGTCATATCCACCCCCTCAAACACGCCCCAACAGCCATG
AACGCCTTCAGTCTTCGCTCCATGGTGCTCGCAGTCGCGGTCGTCTGCGCCACGACAGCCAGTAGCGCCGAGGAGATTCACCACAGCCACCGACTCCTGC
AAGCCAGCAACTTCCATGCCGCGATGCTCCAAGCCGTGAACGCTGAGCGCGCCAAGCAGGGCCTCGCTGCGTTCTGCACCAACTCGAAGCTCCAGACCGC
GGCCCAGCTGCACTCGGAGGACCAGGCCAAGAACAACATGATGAGCCACACGGGCTCGAACGGTTCGCAGATGAGCTCGCGCATCACGGCGCAGGGCTTC
AAGTGGAACGGTGTCGCCGAGAACGTGGCTGCCGGTCAGCGAGACGTCGCGAGTGTGATGCAGTCGTGGATGAACTCGAGCGGCCACAAGGCCAACATCC
TGGGCAACTACAAGTTCTTCGGCATGGGATATGCGTACGACGCCGACAGTAACTACGGCCACTACTGGACGCAGGACTTTGCGAGCGGCAGTAGTGAGCA
GTGTGACGGCGGCAGTAGTGCCACACCAGCGTCAACGACAAGTGCGCCGAAGACCAGCCCACCTGTTTACACTAGCGCCCCAACCACCAGTCCACCGGTC
TACACGTCAGCTCCAGCGACGAAGGGTCCTACTGCCCCCGCAACCACGGCGCCGGTTGTCACCAGCACGCCAGCGACCCGGTCACCCACGTCGCAATCTC
AGTACGGCAAGAAGCCGCGCAAGTCCCGAAAGCAGAAGAAGACCAAGACGCGCAGTGCGGACTGCAAGCCGATCTACTAGAGCGTCTGTGGTCTGTGAGT
AAAGATCTTGCGTGTGCATAGCATAGTGTGATGCTTTTGTTATAAATGCCCATTGAGTTCAACATGTATCTCTGCGACCATGCATAAAAATCCAAAGTAT
CCATCCTAATGAGAATACGGTAATTACTTTTGGAAGGAAACGAGTCAGTACAACTTCAAGTCCATCATGCCAAGTGTTCAGTGCTGTGTTGTGTAGATTG
AAGGTTGTATGTTGTAGGTTGTATCATCCGCCTACTTTTCGATTTCTTGGATACCTACTGTAGTTCTTTCTTGCGGGACACTTGTGAAACGGCTGCAGTA
CAGTCTTCCACTATTAAATTAGCGAGTGTGTGTTTTTGAAGGTCACAGGAGTGGCGCAGTTTGTTGAACTTCCCCTATTCCATGTGCATTCCGTCCACAG
CCAATGGGAAGCCTCATATAGTGTAGAGGGTAGGGTTCGACTTGCCCGCTCTCCAATCCCAGCGTCCACCTTTCTCTTCGTGTTCCTAACGGGCGAGAGG
GTTTGCTGTTGTTGTTGTGCGAGAGTTTGCTGGAAAACCCCAGTCGAGCTGCAAAGAAAACAACAGCAAGCAAGCAAGCACGACAAGCGCAGCAAACAAG
TCCCGCAAGTGCAAGCAAGCAGATCGACAAGGAGGGAGACAGTGGACGCAGCTTGTGGACATTCGCTGGCGACATCAGCAAGCAGCAACAACCATTTGCT
GTTTCGGTTTTCTTCGTCTTGCGTGACGACGGCACTTGCGGATTGTGTGGTGGCGTAACAAGCAAACAAGCAAACAAGCACAGCACACATGCGCTTGAAA
GTGAGTACAAGAACCGCAGCTGCGGCAGCTGCGGGCGGCAACATGAAGAATTTGCTGAGCGACGACGACAACTCCGGCAAGCGCAAGCTGTCGACGCAGT
CGTCGACTGCAAGCGCAACCGCAACCGCAACCGCGCACATAGAGAGCTACAACTACAGCGACATGGGTGGCCGCTCCAAGCTACAGCTACAATGCTCGGA
CGGCCGAGTGTTCGACGTGACGCATGAGGAGGCCATGATGTCCTCCACGCTCTGGATGCTCCTGCAAGGTAGTGACTGCACTGGGTGGACGATATGGTGG
ACTTGTTGGATGCTTTGTTTGCTGAGATGTGAATGTACGAATGTGCGAATGCGTGCGTCAAGATGTAGCGGATAAGAGGGCCAAGACGATGGTGAAACAG
CACATGATCCCGATCTTTGACGTCCCGAGCCACAGCGTCGAACTCGCCCTCTTTTACTGCCGGTGAGTGTGTGCACAGTTGCTTGTGGCTACTGTTGATT
CTCATGCATCGCTTGTATGGGGCTTTTCCGTTGTAGATGCCTGTATAAACAGCAAGTCGAAGGCATTGAGACCGCATTACACGCGTGGGATGATACGTTT
CTGCAATTAGACTCGAAGACGCTCTGTGACCTGGCCAAGGTATCTTTCGCTCGAGTTATCTCCACACAAAAAACGCGGTTTATTGATTTGCTCCCCAATA
CAAACATGCATTGCAGGTGGCGTCGCATCTGGACATCCAACCGCTCGTGGACCTCACGTGCCGATCGATCGCGCAGATCATGTCGGCGACCGAGGCCGCC
CACGAAATCCGCCAAAAATTCGGCCTCGACGACGCGTCGGCCGCCGCAGCCATGGAATGCAGTTGCGGTACGTCTGCTGCATTCACACCAATGTGCATTG
TTGCTTTACGTCTGCAGTGCGTGAAATGTATGTGTGGGCAAGAAAATAGTTGTTGCTAACTCACTAACAAAACTAATTGTTCACGTGTGTGTAGAGCTCC
GCAGCGGCATGTCGGGATTTGACTTCGACATGTTCAACTCGCTCGACCACGACCTGTCGACGGACGAATACGAGCTGGTCGAGTTCGACCAGCCGAGCGT
TGACGACCTCGTGAGCTTCATCAACGGCGGCAGCTCGAGTCGCGGGCCGCCGTCCTCCTCCTCCCAGGCGAAGAACTGCCACGTACACGCTGACAACGCA
GGAGCAGCGGCTGAGAGCAACGGCGACGCTAGCACTGCGGCCAAGAAGAAGAACAAGAAGAAGAAGAAGAAGAAAAAACCCGCCTGCGCTAATACAGCGG
CCCCCGTGGCCGTGACAGACGCTCCCGACTGCAGCGGAGAAGCCACAGCAACTGCGGCGCACGAGACAACCCAGCCACAGCAAAAGCGAGGCGCATCCAG
TCCCGAGAAAGATGAGAAAGAGGACGACAGCGACAGCGGCGACAGTCTGGAAGACGACACCACGACGTCGTCGATCTGTCTCCCGCGCGACCTGCACGAG
AAAATGCGGCTCGCGCGCCAGAATCCGAGCGCGATCTTCCAGGAGTCGCAGTTTGAGGACGACGAGGAGATGGAGGAGCAGATCGAGTCGTTCCGCCTGG
CGCTCGAGTCGGCGCACTTAGAGTACAACCGCAGCAAGGTCAAGGCGAAGCCGCGCGTGACGTTCGCGCCGCAGGACGTGTTCCGATCTACGCTCGTGGC
GTCGCAGCGACATTCGTCTCAGCGGGTCTCGGCCGCGATTTAGTTTTTAGGACGGAAAAAGGAGAGAGAAAAGAAAAAAAGGATGCCGTCAACGAGGAAG
AAAAGACACCTAGCAAGAATGCCACCTCGATCCAATTCAACTCACTTATTTGCAACCGAACCAAGAAGAAAACCATTTGTGAAAGAAACAAAAACAAACG
AGTGTCTGGGCGTGACATTGTTAACTTTCTAGACGAGATCTAGCCTCATGTGGGGCTCGCGCATTCTAAATCGTGGTGATGGCTTAGTCGGAGCCGTTGG
CGATGCGCCACTTGTCGACCTTGAGGTTCTGCAAAAAGCCGATGCGGTGGTGAAAGTACACGAGCCAGAGCACGCCGAGCACCGTGCAAACCGCGATCTC
GAGGAAGAAGCCGTCCTGGATGATCAGGCACTCGCCACCTGCGGCTGTGCACGCAGCGCGCTCGTCAGCGTTCGAGCACGTGTGCGAGCCGATCGCGAGC
ACCGTCTCGTCGTGGCCGAGGCACTCGCGCGTCGTGAGGTAGTCGACGGCCCAAAGGCTCACCGAGTTGGGCCACTTGGAGCCCAAGTTCGTGATCGTGT
TCAGGAACGTCATGTACGTGCCGCCGATCGACGGATCGCTGATGCGCGCAAAGAACGCCATCTAACCATAGCAACCATAGCAATGGGGCATTCATGAGCA
AAGAGGCAATAGAGAAATAAGGCATGGGCAAGCAAGCGCAGGATGGATGAGACTCGTACCTGAGGGACATACATCATGTTGGCCACGAGTTCGTGGAACG
CGCCGGCGAGCAGGATGAAGCCGTAGAAGTAGAAGTGCACGTCTTCGTGGTGCGCCATGACCGACGGCGTCATGTACACGATGCCGGCGTAGAACAGTCC
GCAGAGCATGCGGAACGGGTACCCGAGCAAAAAGAGATTGAGCGGCTTGTCGGGTTTAATGAAGCGACCGAGGAACACGGGGATGATGATGCCGAGCGGG
ATGAGCACGGGCGAGAGCATCGCGAGCTTCTCCTTCTTCATGCCGTACTCAACGAGCTTGAGCGCCGCGACGGACTCGGCAGCCGCGAAGCCGATCTTGC
ACGTGAGCAGCATGACCGAGAGCGACACGACACTCGGCAGTCGCATGACCGCGTACATCTGCAGGTACGTGTCCTTGATGCTGAGCTTGTCGTCGTCCGA
GGTCTCCTGCTTCTCGGCCTTAAACAGCCACACGCCGACGGTCGTGACGAACATGACCCAGCCCCAGAAGTGCATGAACCCCGGCAAGCCGATGATGCCC
TCGTCTTGCGGCGTGCTGCGAAAGTACGTGTTGCACGTCGCCGGGTCGTGGAGCGCCAGGAAGCCGACGTACGCAACGAAGAAGCCGAGCGTCTGGCCCA
CCGAGTTGCACGTGGACGCATGCGCGACGTTGCGCTTCGAGAGCATGGTCAGCGCCCATCCATCCACCGCGATGTCCTGCGTCGCCATCATGAAGTAGAG
CACGAAGAAGAAGAGCGTGAGGTACACGACGTGCGGTTTGCCGTCGTGAATCGGAGTCTTGGCGTCGTCGGCGGCCACGGGCGTCTCGCCCAGCAGGTCG
CCGATGATCCAGCTGCCGCCGATCATGAGCGCGGCACAGATGAACTGCACGGGGATGAGCCACGACTTGCGGCGCCCGAAGCGGCGGCTGTAGAGCGAGT
CCACGAACGGTGCCCAGAGCAGTTTGAGGCTGAACGGCCACGACACGAGGCTGAACGTCGCCTGGTCCGCGTAGCCCACCTTCTCCTGCAGGATGAACGG
GATACTCGACGACAGCCCCATGGGGATGCCCTGCAGTGTGTACAGCAGCAGCAGCAGCAGCATGGACGCCCAATCGCCCGAGTCGTCGTCTTCGTCGTCT
CTGCCGCCTCCCTGCTTGCTGTCGACATGCGCTTTCCCGCTGCCGTTGGCAGTGTCCGCCTGCGCGCCTTTTGCAGCCTTCGCCTTCGCTGCTGGCGCCT
TGCGTTGCGTGAGCTTCGCCATTGCTTTGCTGATTCCAGAAGTGGAGTGATGAAATGATTGCTGGTGATGGTGATGACGTGGTGGTATCTCGTGCAACGG
GTACACATTCTGCAATTTTGTGCTTTTGACGAGGTCTATTTCCGTAATTAGAATCTCTATTTTTATAAAAATAAATAACTTACCTGTGTCATTTTCATCT
TCTTTAGGAAACTGGGTTACACTCGAAAACGTAACCTCTTGACCCCCCTGATTCTGCTGTGGCTTCTCTTTTTTTTTTCTTCCCCATAATGGCAATATTC
CCGCAGTCGCCCGCAGCCATCGGTGTCCGTAAGAAGCAATGGCGACGCTGTTTGGAGACCTGCCGGCCGCGGGGCTGCGCGCTGGACGCAGCAGCGCGCT
CGTGGCCGCAAATGGCGCCTCCGTCGTCGGCTCGAGCGACCGCGCGCTGCAGTGGGTCTACGACGAGGAGACGTCCAACTGCATGCACTGCAACACGCCC
TTCACACTCATCACGCGCAAGGTGAGAGCGCGCGCATTGTGTGTAGTAGTACTGGATGCTGTAGTAACGCTAACGCTGTGTGTGTGAATGTTGTTGTATC
GGTAGCACCACTGCCGTCGATGCGGGAACGTCGTTTGCCACAACTGCTCGCCGCACAAGCGCCGGATCTCGGTCACAGATCCGTTTGTAAGTATACGCCA
TGTGATCGCGACTTTTACGTCGAGGGACAGCATCGTCGTTTTCTCGTGTGTGGAGCCTAGTGACCAATCCTACGTGTGCTTCATGATGTGTATGCGTATG
TAGCCGATGCGCGTGTGCAATACGTGCTATGCGGCTGTCGACGAGCATTTCGCGACCCTGGACTGGTCAGGCCATTCCGCCGCAGAGGTGAACTATATAT
CCCATATCCAACCCACTGTGTGCAGATGGGCGGCAGGGACTGATGCTGGTGTTATTGTTACCATGCAGGTGCAAACGAAGGCCGACCCGGTGATCGAAGG
CCGCGTGCACGTGGGGCAGCTGTACGTCAAGGTGGTCGAGGCCATCGGGCTGCCGTCGACGGACTCGATCACGACGAGCGACCCGTTCGTGCGCGTGATG
CTCACGGGCAAGTGGTCCCACGGCCAGGAGTGGGGCAACGACCTCAAGAGCATCAAGTGCACCAAGAAGAAGTCGCGCACGCTCAACCCGCGCTGGCACG
AGACGTTCGTGTTCAACGTGTGCGCGCCAGGCGCCGAGTTGGTCTTCGAAGTGTACAACTACGGACAGCTGAGCCAGCCGACCAAGCTCGGCGAGGCCAC
GATCCCGCTCACGCAGCTCATGGACCAGCGGCGCCACAACAAGTGGCTCGACCTGCTGCTTCCCGAGAAGCTGCATCGCGCGGGGCTCAACAATGACGCG
CGCGCCGGCAGGATCCACGTGCTGCTGCACTACAAGTTTTCGCGCATGGCCGAGTTCTGCTCGTACTTTTCATCCGAGCAGGAGTACGTCTACGAGTGGC
CGGAGTTCCAGGCCGCGCATCTGTACAGCAACTTTTGGGTGCTGCTGGACAACCTGTGGCCGTACCTGGAGGTCGTATGGCAGATCCTGCCGACGCTCAA
CTGGGACCACCCGACACACTCGTTCCTGTGCTTTGCGCTCTGCGTGTGGCTATGCCTGTCGCTGCAGTGGCTGCCCGTGGTCGTGCACCTGGCGCTCATC
GCGTTCGTGCTGCGCAACTACTTTGAGCTCAACATCCACTCGTTCACGGACGGCAAGGAGGCCCATGGTGCACGCGGCGACCACGGCGGCACCGGCACTG
GCGGCGGCGTTGGCGCTGGAGGGGGAAGCGCGGCGGTCGAAGCCGAGGCCAATAACGGTCAGTTCCGACAGTACAACCTGCCATCAGGTTTCAACCACCT
CATGAACAAGATGACGCACGTGACGATCGACCACGAGACCAAGCGCACGCTGCAGTCGGTGCAGAACAACATGGCGTGGTGGTCGAGCATCATCAACAAC
ATCGAGCTCATGTTCTCGTGGGAGGACACGTTCTACACGGCGCGCATCCTGCTCTACCTCATCCTGAGCTGCGTGCTGCATATTGTCGTGCCCAACAAGT
ACCTGCTGCTGGCGCTCGTGGTGTACCTCTTCGTGCAGTGGACCGTGCCGTTCCTGTGGCTCACGCACTTTGTGTACGCGATGCGGCAGTCCGTGCGCTC
GCTGATCCACCAGCACCGTCTCACGAGTCGCAACTCGCAAAATGACCTGCTCGCGAGCCGCGAGGCCATGCGCGCGGCGTCGGCGGCGCAGTCGCTGCGC
CACAGCGAGTCGCACCCGCGGCTGCGGCGCACGACGTCCAACGCGAGCGCGCGCGCGCACATGAGCGTGTCCAAGAAGGAGGAGATGTTCGGCGCCGCGG
CATCCGCGCTCTCGCAGCGCTTCGTGGTCAACGGCCGCAGCAGCAGCGAGCGCATCCCGCGGCCCGCGTCCTCGAAGGTCTAATGAGCTTTTCGTTGTCG
TTTGGTTGCCATTAGGGGGGAGGTACACTATCATGTGATTGGGTACATGTATAAAGCGTATTGCATATACCTCTTTAACTTGTTATAGAGTGTTGTAGTT
GTTGTACCTAATTGAACTCAATTTCCTTCAGCCTCTATAAACCAAATACTACTACAGAACTTATTATACGAGGTACAACGTAGTGGTTATGTCGCGTTCC
AACAGGAACAGTCCAACTCACCTCCCGAATAGAGCGCTCTGCTCCCTCTCCCCCTCTGCCAGACTGACGATTCCTCCACATCACGAGGCGCATCAGGCGG
CCTGCGTCCCGGTCTTCCTCCTCCCCCACCGCTGTCGATAGGCCCTTCCTGTGTGTGATAATACACGCATCTCTAGAAGTCCAGGATGCTGCTGCAGCGC
GTGTTCGTGTGGCTCTACACGTGCGCCGTGTTCCTGCAGACGCGCGTGAAGCACAAGAAGTGGGTCGTGCTCGTGGTGGCGGCCATGTATGTGGCGATGC
GCGCCACAGGCACATCACCGCCGCTCATCGGCGAGGCGCGCAAGGTGCACATCAACCCGATGAACACGGAGACCAAGGACGACGGCATCCACATGGCGCC
CACGCCCGTGCTCGCACCCTGGACCAACCACACGTTCGAGTGCGTCGGCTGGAAGCGCATCCACACGTGCGTGGACGACGGCAGCAAGACAGCCGAGGAG
ATCGAGGCCGACGCCGCGACGCGTGAGCCCGAGAAGGACTTTCTGGGCTGCAACGAGGAGATCGGACAGCAGATGGCCGGCTACTGCATCGTGCGCAACC
GCACGTCGGGCGACCTCTTCAAGCTCATGATCAGCAATTGCGACTCGCTGCCCAACGGCCACTACACGTGCGCGCAGGCGCGCGACTTCTCCGAGTACGG
GCTCCACTCGGTGCACTACGAGCACTCGCCCGTGGCGCCGTCGCTGGCGCTACACAACGTCAAGAGCAAGCGTAAGCCCACGAACGGCGTGATCATGATC
ATCTACGACAAGGTGCTACCGTCGGCGTACGCGACGATCCGCATGCTGCGTGTGCAGGGCTGCGAGCTGCCGGTCGAGCTCTGGTACCGCCCCGACGAGA
TGTCGATCGACAACCCAATCATCCACAAGCTGCTTGCGGACTACAACGTGCGCATGCGGCCGATCTTCGACTCGCGCGCGCAGGGCTTCCACGTCAAGCC
CTACGCCGTCTACTACAGCAACTTCGACAACGTGCTGCTGCTAGACGCCGACAACCTGCCAGCGAAAGACCCGACGTACCTCTTCGAAGAGCCCGAGTTC
CTGCGTACGGGTGCGATCTTCTGGCCGGACTACTGGCAGCCGTCGAACTCGCTCTTCCAGCTCACAAACACGAGCCTGCTGTGGCAGCTCACGGGCGTCT
CGTACGTCGACATGTTCGAGCAAGAGAGCGGACAGGTGTTGATCAACCGGCCGAAGAGCAAGAAGGCGCTCGACAAGCTCATGTACTACTCGACGCACGA
GCCGCGGCTCATGGAGTCGCTGCACCTGATCTGGGGCGACAAGGACCTGTTTCGACTCGCGTGGCTCAATGCGAGCCAGCCGTACCACTACATCTCGTAC
CCGCCGGCTGTCGGCGGCCTCGACCTGATGCAGTCCAAGGGCGTGTTCTGCGGACTCGCGATGATCCAGCACGACGTACAGGGCGACCTCGTGTTCTTCC
ACCGCAATTCGATTAAGCTGGACGGGTCGCTGGACCAGCCGCGCGTCATGACGCACATCCAGGAGTACGCGCTCGACGCCAACCCGCAGGACTACCGCAT
CTTCCAGGCCGTGTACGCGCACAAGGAGTGCTGCTACTACATCGGCACGCAGTCGCTGCCCGACGGGCGTCCGGCGTCCTACGTCACGCCTATCGACACG
ACGATCTACACGTCAATCGAGGAGCTCGCGATCCAGTTCTCGATCGAGGCCAAGACGCTGCTACTCGAGGACGAGGCGGGGCTGTCAGCAGGCACCCACC
GCCGCCTGCACGCGCGCGACGCCATGAGCATCCAGTACATCGTGGCGCTGTTCCTACTCGCGTACGTGGCGCTCATCATCGCGTTCGTGTGGTGCAAAGC
GCGGCCCGCGCGCGAGCGGCTGCCAAGTCGGTGGAAGCCCATCGAGCCCACGAAGGAGAACTAGACGACAAAGTTTTTATATAGTATAATGGAGCAGGCG
CAGAGGGCGATGGTGAGTGAGGTATGCAGGCGCATTGCGGCTTTGCCCATTCGCCACGCGAGTGCCACTTCCGCAGAAGCAACAGGAATGCGGACCTCAA
CGTCGCGACGGCAGCGCCCATTGGCGCTTCTACGCGGCGCAGCAATAGACGAGATAGGGAGACAGAGAGCAGCACGTGCGCAAGATGGCGATTATGGTTG
CATTTGCATCACCACCAGAACACAATGCATGATACGGTTGTTCGCTAATCCGGACTGTGTGTGTTTATAAAAGCCTTTTTGAACCAGGTCGCCCAGTAGC
GTGTTGTTTCTCTCGACCTTTATTAGGAGTCGACGTGCAAGTAAATAGGGGTAACGTGAACAGACGGCTCGTTGAAGTTCTGCAGGGGGAGGGAGTCTTC
TCTTTCACATAATAAAAACCCACAGGGAAGAGAAGGATGCAGGCGCTGCGCGGACGAAGCCACGCGCTCGCGGCACCGTGGCGCAGGAGTGTCCCCAGTA
GCAACTTCAGCAGCTGTGCACACAGCGCATCAACTGCAGCGCGCAGCTCCCGACAGCACGAGCAGCTTCGCGCGTTCTCGCCCTGTTCGCAGGAGCTCCA
CGATGTGTTCAAACAGACACATGGGGACAGGTGGGCGGCGCTCCTTTTTGGTGGATCCGTGCTAGGTGTCGCAGCGTGCTTCGCCATGGCTGCTGCGACA
GATGATACGACGAAGTGTGAAGCGCTGGGGTGCGAAGAGATGTATCTCCACGGGTTCTTCGATCTCCAGCAACGAGACGAAGACGTGGCGCTGCTGTTAG
CCCCTCATGCAGCACGTCCGCAGCGCAAAGAGGACGAGGACGAGAATAAGAAGGGGAGTACCACCACGGAAGTGCAGGACGCAGGCAACAAACCCATCGT
CGCGCCAGGAGCAGCATCTGTCTCGCTTACCATGGATGAGCTCGCGGCGATGCGCAAGGCGCTTCGCAAGCGCAAGACTACGAGCGGCAAAGATCGCTTT
ATCATCAGCAGCGCTGCGGTGCGTGGAGACCGTGCGACGATGGAGGACACGTCGTTCGTATCGGACTGCAAGCGGTTCGCCGCGGTGTTTGACGGCCACG
GCGGCGCAGCCGTCGCGCAGTACCTGCGGAAGAACTACTTTGCACTGCTGGGTCCAGAACTCGCGAAGTTGGACGAAGATGAGAGTCTGGAGCTGGACGC
CAGGAAGAAACGGCGGCTGCACATCCAGTCGCTCTTGAAGACGTCGATGGAGAAAATTGACGCCGAGATCACGCAGAAGAATGAGTGGAAGTACATCGGC
TCGACGGCCACGGGCGTGCTCTTGTACGACGACGTGATCTATAGCGTGAACGTCGGCGACTGCCGCGCCGTGCTCAGTCGAAGCGGCGACGCCGTGGAGC
TCACGCGGGACCACAAGCCGAACGACCCGAGTGAGCAGAGCCGCATCGAGTCGCTCGGCGGGCGCGTCAAGTGGCACGGGTACGTAGACGCGCAGGGCGA
CCCGATCGAACCCTACGGCGCGTACCGTATCAACGGCAACCTCGCCGTGGCACGCGCGATCGGCGACCGGGATCTACGGCCGTTCGTGACGGGCGAGCCC
GAGGTGAAGGCGTTTCCGCGCGACATGAGCAAGGACGAGTTCATCGTGATCGCGTCGGACGGGCTCTGGGACGTGTTCACGAGCGACGAAGTGGTGACGT
TCGTGAAGGACGTCATGAGCGGCGAAGTCGGCGGCCGCGAGTCCTGGCGCAGCGGTGGCCACAGTGACACGCGCGTGCCGATCTTCGAGTGGTCCCAGCA
GTACAAGAGCGACCGCAGCATGATCAAGGCTGCGCGGAAACGGCGCCAGATGCAGATCGCCACCTACCTCGTGCAGGAAGCGCTCTACCGCGGCACGTCC
GACAACGTCTCAGTCATCGTCGTGTGGCTCCGATAAGAAAGTGTTGGTGTATATAGGGGGACGAAGGTTTGTATGGAGTAAATGGCGACAGTTGCTGTAA
CCGTGAAGATGATGATGGACAAGTGGTTTTGCTTCCTTGCAGCGACTGGTGTCTGAATGCGTGCAAGAGAAAGCGAGCGACGTATCAATACCAGCACTCA
CGACAAGGAAACAGAAAACCCAGAGTCAACCCAGGGACGGCTGCGTGGCTTATGGGTGGCCAGGCCAGCATACTGGTCCACGGGTGTGCCCAACAACACT
GTTGCGTTGTAGGTCTCTTCAACCCAAAACAGCCATGGCGGGACTGAGCGCAGCAGCACACACTGCATGCGCACTGCTTCATGTGAGAACACAGCTGCAG
TCGTTGTCTGAAGAATGGAAACGGTGGCAGTGTTGGTCTGCATGCACGAGCCACAAAGGGAGGCAGGATGAGTGGTCATACGGGACGAGTCTCACACATC
TCACCCACTCTGCAGGTCCTGTATGGTCCAGCAGTCAACAACCTCAACTAGCGCAGTCGCCAAACAAACGTGCGACACCAATGCGGTGTTGGCTCGAACG
AAACAATGTGCCAGAATCCACTATTGCACTTTGGGATTACGGTCCACCCGGATGCAAATTTCACGCACAGCGCATGGGGATGGATTGTTGTGCGCATTGT
GGGGTTGTTTGGTGATTAGTATTGCACAAGTCGCCTTGCAGTTGTGGTCTGACTATTGGAGACACGTCAGCGCAGTATCTGGTACAAAAATTGCCAATTG
CAAGGCAGAGAGAAAAGCCATGAAGAATTGATTTTCTTTCTGCGTTTGCTCGCTCTCTTTTGGGCAAGAAGACAGACAGAGATCGAGCGAATAAAGTGTT
CCCCTAACCGCTTACTCA