Description :
From Genome Similarity Track
Location :
contig_1:21713- 26690
Transcript NameFunction/comments
g3.t1hypothetical protein

Sequence
4977 bases(100 bases per row)
GCAGGTTGCCCTGGATCAGCTTGCTCGTCCCACCGTTCCCCGTGCTATCTGGATCCCTGGATATCGCGCTCGTTCTCGTAGGGCGGCCGCGGACGTTCGC
CCGTGGTCGGCGAGCGCTTTGAGCCGGGTCAGTGTCTTAGAGATGGACATCGAGTTGCTCTTTCATCACCTGGCAAAGCCTACAAACTGGCTTTTTCCGC
CGCAGAGTCGATCGCCTCGTCGCGGCGCTTGGTCACCCGGTCTGATCACCGAAAGCAACATTGCGGCACTTTACGCGACGACGCCGTGGAATTCTCTCAA
CGTCTTGGTGACGCCTTTATTTTTTGAGGTGACTGGTTGGTTCGAGGCGATGTCTCGGAAGTATCTGGAAATTGAAGATGATCACCGGCAGGCTCTATGG
GAGGCTACGCACGCGTTCATGATCAGCTCCGCGCTTCGTAAATCGAACACATATCTGGCACGTCTTTGGGAAGATCGCAAGCAGAGACGATCACGTTTCG
GTGCCGTCTGGAAACGCTTCCTCAAGTTGATCCTGCAAGGGATGATTGCAGGGCACTGCGACTTGGATATTCTGCTGGACCCTTTCTTTCTGCATTATCC
CCGGGCGCACGAACAACGAGTTTGGTACCCTGGGGCTTGGTTGCAGCTCTCAGCCATCCAACCTGGTAGACGCCCTACGTGCCGTCGATCTGGTTGACCC
GTGGCGCAATCAGTATCGCGGCCACCTTCAAGATCATCCGGGCTCCCAACTGCCCCGCCTCACCGGCAAATTCTCTCCTGTCGCCGACTAAGATGAGGTA
GTTAGTGGATCGTATATCTTCTCAACATGATCTCCACGGCTTCTTCCTTCGTTGTTTTTCTTCATCATTTTCTTGCTTTATCGAGCATCCCGCTCTGATC
GAGAACAGTCGTCCTCGATCTACACAACAATATCACATAAAAACCCTTCCACCTCAATGTGCGACCACCTCACACATTGTTCACACCACTCCTCCGCCCG
CAACAGCCAGCCTGCTACGAGCTCTCCTCCTCCACCTCGTGCGACTGCATCACAGCGAAGCGATTCCGGTTGACGACTCCTCGCTCGTATTCGCGCAACA
AGGCTCCGCAATTCAGATCGGCTTCATCAACCCACGAAAGCTGATCGTAACCCTTCCAGCGCACCTGAAATTCCCGGTGGACGCGACCATATCGCGTACC
GTCGACCTGATCGCATATTCACGATCTTCTCCACCTCGAACTCGTCCTCATCGAGACCGCCTTCCCAGCTGTCCTCGGGTAAAAGCGCCTCATCAAAGTC
GAAGCGATCTTCTTCGTCCACCACCAGCGTCAGCGTGGGGCGATCGAGGAACGATCGCACAGGCTTGAGTTTTGACACATGGACGATCGGGAATAACCGA
TAGTTGGTGCCAGCGACTTCCAACCTTGCTGCATGATTGTCAAGCATCTCGATCACCCTGAACGGTCCGTGCCACATGTGGGCTAACTTGCGTGCATAGC
CCTCCTTCACGCGATCTAGGTACAGCCACACTTGCATATTGGCCTCAATCCCATGAGGTCGGACCTGATCATTATGCCCGTCTGCTCGTCCTTGAATGGC
CTCCCGCAGGGACTCATTAACCTCTTCTCTGGCTCGACGATAGTGGCTCTGTATATGATATCTCCACCGACGAGGGTCACGATCCCGGCGCGTGCTTCCG
AGAGGTAGCGACGCTTCTAACGTAGATTGCGGTCCCACCCGTGTGTCAAGTAGAACGGCGTATCTCCTCGAACCCGATCTTGGGCCGTGTTGAGCGCGAA
CGTCAGTCACTCCGCGTACTCATCCCAGTCCTGTTGGTTGACGTCTGCGACATACATCTTCAGCGCGCGTGTCAACGTTTGCACCATCCGTTCTGCCGTC
CCATTGGCCTGCGGTCGATAAGCCATAGTGGCCCTCTGTTTCTGTCCCACTATCCTGCTAAAAGCACGGAAAAAATCAGACATGAACCCAGGTTCCCTGT
CATGCCGGATAGCCTCACTGGCTCCAAAACGCCGGAAGACGCATTCCTCGTAGTTCTCCGCAATCGTCTGCGCTGTTCTTGACGCGCTCGCTTTAGCGAT
CACATAACCCGAGAACAGGTCTACCCAGATCAACAGCTCCGTATTGGCTTTGAAGGACTTGGGCAACGACGGAATGTGGTCCATAGCGATGATTTGAAAC
GGGTACGTCGCTTGCACGTTCCCAGGGGATTCTCCTCTCACGAAGGGTCGGCCTTTCCCTGTCTCACAATCTGTACATTCTCCCACATAGCGCTGAACAC
TTCGGTATAAGCCCCTCCAGTGGAAGTGTGATCGGATTCGTCGGTACGTCCTTCCGATCCCTTGATGTCCCCCTTCCAGACTTGCGTGGTATGATGTAGA
AATCTTGTTGCAGGGTCTCAGGCACCACCAGCTTCGCGATCTCGTCACGGTCCTCCTCCTGCCGCATGGCCGACGGGCAATAGAACAGCAGATCGTTTTC
GTCCATCTCGTAATCGTTCGCGACCTTGGCGCACGATTTAGCTTCGGCCGCGGTGAGAGCCTCGACGTTCCCTTTCAGGTATGCTTTCAGATCGACGATC
CACTTCTCTTCATTCTGTGCTTGGATGATTCGCTCACCGCGTATACGCTGTACAATCGCTTCTTGCAGGACTTCAGGACTCAGTCGTCTGCGTCGCGTCG
ATCTGGTCACAGCAGACACACGGACGACGGCATCGTCGTCCCTCATCTTGAGGAGCTCGTCCAAACGGTTGAGCGTGATCAAGTCTTGTTGATCTTCGTC
TGAGGTGACTACGATCCCTTCGCCTCGTTGGAGAGCTTCACTGGCTAACTTGTCTGCACTCTGGTTCCAATCTCGTTTCATGTGTAGGAACTCGTGCTTT
GGCCACGACCTGAGCCGATCCATCGCTTTCTCGCGCAACAACAACAGGCCAGGGGCCTTGCATGCGATCTCACCACGCATTTGCCGGATAACTAAATTGG
AGTCGCCGCAGATCACAATCCGCCCACTGTCCATCGTGGACAGCAGATCGAAGCATAACAACAACCCGCGGTACTCCGCCTCCTTCACCGTTAGATCGGG
CATATACTCCGAAGCGGAGGTGACGATCGTCCACTCTGGCAACTTCCATATGATCGCACTGTAAGCTCCACCACTGCGTTTGACGCGTGCCGATCCATCG
AAGCTCGCGACCAACAAAGTTTCGTCCGCTCCGATCGTAGGGGGTGGCATGGTAATCGTCTGTCGGGGCTGCTTCACGGGTGCGATCGCGATCAACGCCT
CGTCTACTTCCGCTCGAGGTGTGATGCTTGCTGCCATCGTGCCTAAGATTTCGTCTTCCCCTTTCGCGCACTTCCTGATCTCCAGTGTCCATTCTGATAG
CAAGGCTGCCCAGTTGCCAAGTCTCCCTTGGAGACCGGCCGAATTGACTAACCAAGCCAGCGTCGAATGCCTGGACAGCACCAAGATCGATCTCGTCGTC
AGCAAGGTGTAATTCACGTCCAGCATCCGCAAGAGCGCCAGAACTTCTTTGTCGACGATCCCGTAATTGATCTCATTCGGTTTCAGGGTACGACTGGTGA
AGGTTACTGGCCAGTACACGCCATCATGTTCTTGCACAAGAGCCGCGGAGATCGCCCACTGACTCGCGTAAACTACGATCACTGGAGTGCGATCTGCGTC
GAAATGCTTCAGGATCGGTGTGGACACGATTTTTGGCCTTCAACATTGTGAACGCGATCTTCGCTCGGGCCCAGCGGTCAGCGTCTTCCGCTCGCGGGAC
ATCGCCCCCAGTTACTTGTTCGCTGGGAATGGATCTGTCCTGTCGGGCAATCTCGTGGAAATCCGCTTCACGCAGTTCGTACAAGACGGCCGCATAGATC
GCGAAGTCTTCGATGAAGCGACTGTAGTAGTTCAAGCTTCCAAGGAAGGACTGCATCGATCGCAGTGTCTGCGGGAAGGGAAGGTTGCCTAACACTTCAA
GATCTTTTGGGTGGGCTTCCAAACCGTCGACGGACACTCGGTGTCCCAAGTAGTCCACTTTTCGTCGGCCACAGAAACTTTTGACCACACTGATGGACAA
ATTCCACCGTTCGCAAGCATCGAGTAATGCTTCAACCTTCTCACACAGCAAGTCCCAAGTGATCGCAGTCACCAAAATGTCATCGATGTACGATCGTCTT
CCCAACACTGACGGTTTCGGCTCTAGTTCCGGCTCGCCTGAATTGAACACGTCGATTGGCTTCGACGAATCGTGACCGGCGCGGATTCGGAGATGTCCAT
ACAGCGCGTTATCAATCAACCGCTGGTAGATCTGTGGCGCATTCTTCAGCCCGAAAGGCATACGCGTCCACTCGAACAACCCGAATGGCGTGATAAAAGC
GGAGATTTTCCGTGCACTCTCCGTCATGGAGACTACCCAGAAACCACTTGCCATGTCAAGTGAGCAATACCAGAGCATTTTGTCCAGGTCTTCCAGGAGG
TCGCAAATCAGCGGCATGGGGTACACCATCAGTCTCGTCAAACTATTCACCAGCCTGTAGTCAATACAGAGCCGGATGTCAACGCCGTTCTTCTTGATGA
TGATTACGATCGGGGACGCCCACGGTGAAGTCGACGGCGTGATCATCTTCGCCGATAACAGGCTCTTGATCAGATCCGACAGCTTCTCGCGGAACTGTGG
AGCGACTTTCCGGACGCGTTGTGCAACAGGAGCCGCTCCTCCCACATCGATGTCGCAGACTGCGCCAACGGCGCCGGCGGTAGCGCGTTCCTTTCCCGAT
CAGAAGATGTTTCCGTCTCCAAATTATCTGTCGCAGCCGATCGATTTCTTCCGGGTGTTCGACTCTGGATCGCCCACTGGATATCTTCGATCGTAACCTC
ATCGGTGGCAGTCACTACTTCTGGTAGAATTGCCAACTGACGCTCCACATCTTCAGCGAAGAGATCGCCACCTTCGT