Description :
From Genome Similarity Track
Location :
Scaffold_2249:2171- 3473
Sequence
1302 bases(100 bases per row)
CCTTTTTGGCGCTTGCCTTTCGATAAAGGTGCAGCTAGCTTGATTTGATGCAACGCGTTGGCAATGGCTGGGAGATGACCCATGTATCCAAACTAAAGCT
CCAGCAAACCACCAAGCAACGCTCCTTGCTCACTAAGAAAAGCCGAGCGTAGGCAAAAGCCGTTTCGGTCCGAACAAATATGAAGACCATAGGATAGCAC
TTATGTTGATACTAGTGTGCCGCAGTGTATCTTACACCAAAGGTTCCAAATGAAACGAGTGTCCACCCACCAAATTGAAGTTTGTTTGTTCCGTCTGTCA
CCCCCAGCACGTCAGGACGCTGCCACAGTAGTGTCCGCGCAACCGTCCGAAATAAGCGTCGCGAAGTGAATATGATGCCTATAGAAGGCTCCCCATTGTC
CAGCGTATCGGTGAAACACTCGAGAACTATTAACTCGTGTTGAAAGTTGGACGGCTGGCGAGAAATGCGCAATGCATATTCTCCACATCTTGTTGCATTT
CCTAACGCATGTGTTGCAAAAACTGGTGTTTGGTAGTGCACATTCACGGCGTTGCCCACTCCATCATATCCGCGTAGGTGGTGACTGAAAAATCACCGCG
TTTCTAGAGCTGGTGTGCCCGTTTCTTGAGTTGGCCAACTGTCGGCGAATGGTCGAGATGCTGATCCGAATCATTGTATCTTATTCTCAATATGGTCAAA
CACTGTTTAAAACCTTGTTCACCAAGAAGCAAATTGTCGATCTCTGCTAACAATGGCTTATGAATACCGGTCCTATCTCGATACAACAACTGCAGTGATC
ATTTCACTTCGCGATAAGACAAACTTATCGTCGTTATCTTTTCGGATACGTGCCACAGCGGTACAGCAAACTGAGATGTAcacgccagcagcgtggcatT
TCTTCCGTTGTTATCCAGGGAGAATCGAGCATTCTCGAGTCCGTCGATTACTGCCCTCGCTTCCTCGATTGAATCAAATCGCACTGGGTGCTCCATGATT
GCTGCGTCAATCTCATCTTGAAATCGCTGAGGTATACTGGTATCGCGTTGGTCCGATAAAGAAGCAACGCTGCTGTCATCGTTACCACTTTCGTAGTTGT
ACTcatcgttgctgttgttgtcacCTCTCAATGTATCTTCGACCAGCCCAGCGTCAGGAGACTTCTCattgctgtcagcactgTGTTGTCGGCGACGATG
CATGGCTCCAGCGCGACAGCGAGTAATTACGCCGGAAAAGTCTTCACTCTCGCTTGAAGATTGACTGACAGAAATGGAAGACTGAGGCCCAGAAGAGCGC
CC