Description :
From Genome Similarity Track
Location :
Scaffold_65:217090- 224476
Transcript NameFunction/comments
Hyaar_Emoy2807548Zinc (Zn2 )-Iron (Fe2 ) Permease (ZIP) Family
Hyaar_Emoy2807550GF20493
Hyaar_Emoy2807549GF20493
Hyaar_Emoy2807551PERQ amino acid-rich with GYF domain-containing protein 2
Hyaar_Emoy2807552hypothetical protein

Sequence
7386 bases(100 bases per row)
CACGTTTCCCAATCTCCAACTCCCCACCGCCGTCGGACAAGTCGAAAAAAAAGCAAAAAGCAAAACCGCGACGTGATGCGCGCACTTCATCCGCAACACT
CCCTCCCTCAGTCTCCGATTTCCTCGTCCGCACCAAAGTGCCCCTCCACAATCCCGCAATACACAAGCCAGTAATATCCAACAACCAGAACGAAAAGTAC
CAACCACTACAAACAAATACACCCAAGCCATAATGGAGCCACTGGACGAATTCAAACTGCTGGCAGCGCTCGGCATCTGGATCCTCGCGCTCGTAGGCGG
CACCGCGCCGCTCCTGAGTCGCCACCGCGTGAGCAAACGCGCCAGTTGCGTGCTCAACATGGTGGCTGCCGGCATCTTCCTCGCCAGTTCGTGTCTGCAC
TTGCTCCCGGACGCGCAGAACAACGCGGCGCTCATGGAGTGGGGCTGTGAACACACCGCGCAAGTGTTTCTGGCAGTGCGGACGCGCTACGACGGGGACA
AGACGCGGTGTTTCAAGTGGGCCAACTTCTTCTACGGCTGCGGCTTCCTCCTGGTGCTCCTCATTGAGGTATTGGCACATACGCTGCAACGGCATTACAG
TAGGAAAGGGTACACCCGCCAGGAAGAGGGTACAACAGGTGAGCTGCTATTATTGGCTGGAGACGCTGCGGCGACGACGACTGGACGGCAGTACTTTAAT
GGTACTGGCGGTCCTGTCTTACTGGAAACTGGTGGGGCCTATGGCACACAAGGAAGAGATGAGAAACAGCACGTGAGTGGACAAGGAGACACTGACGACG
ACAGCAACGAGGAGCCCCACGCTCATATCCACGGTATTGTCCGGGGCAACTTTATCCTGGCACTTGTCGTGTTCATTGCCCTGTCTTTCCACTCGGTGAT
GGAAGGCATGGGCATGGGCGCGTCCAGCACGCCAGCATGGGATATCCTTATTGCGATCTTGGCACACAAGTCTCTTGCAGCATTTGCATTGGCACTGGAG
CTCCTGCATCATGATGTCCCGCGGATGCAACTCTTGTCGTCCATTGCAGTCTTCTCGCTCATGACGCCCATGGGCATTTTGTTTGGAAGGTTGCTCGTGG
ATACGACGCAAGCGACGCCTGCGGGTGGCGTCTGTGCCGCGCTTGCTGGTGGAACGTTCCTGTTTGTTGCCATTATGGAGATTATCCCACGAGAACTGCA
AGATCCACGGTACCAACTCGAAAAGTGCTCGGCTCTGCTTGCTGGATACGGCGTTATGGGCGTGCTCTCGCTCTGGACGTAACCACGCAGGTTGACTTAA
TGTATTTTTCAAAGACAAAGAAGTAGTAGGTTGAACGTTTAATAATACTCCACAATGCGCGGTCTGCCGTTGGCAGACGTCAGCTAAAGAAGTGCCAAAG
ACGTTGAGATCGTGAAATTAAGGAGAATAGACCGACTTACTCAAGTAGCTAGACCAACGCCCAAATCAATCTCGATATCCTCGCTCCTGTTTTACTCCAG
CTCAATGTGCCTCGGTAATATTCCAGCAAAGTGACCGTATCGCTGCATCATGATCATCACCATTTCCTTTCCCGGTCAATGTGGTCGCAGCGAAGAGACG
AGTACTCGCCACCTTGAGCTCACTCAGTCCATTGCCGCTCGCTCGCACTTATCTTCCGTACTTCTGGAATTCCCACTCACGGTTGTCTAATGGACACACC
TGGCGGGTCTTGAGCCATCGTGAGATGCAGTGGAAATGAAAGGCGTGATCTGTTACCAACAGTACACATACATACATACATATGTATACACGAGTATAGT
CAGATGCCGGCCGTGACACAACCCCCACACCACCATGCATACACGAAAAAATGACATACTGCAAACGCCCCAGGCCACTGTGCACTCCTCGCTGGTAGCT
GACGCCTGATTGGCCTGGCATTCAATGCACAAGTCCATAATGTGATTGCGGCAAATAGCGCAGTTGTCCACCACAATATCTAAGTAGCAAATGAAAAAAA
AAGATAGAAAAGATATTTCAATATCACAGTAATCTCGACAGTAGGATGGTAAAAATCGAAAGGATATAACCGCAGCAGTAATTACGCACCCCATGACCAG
AGAGCCACAGCATTCCACTTCTTGATCTCAAAGCGCTTCTCCTCACTTGGCTGCGTCGTCAACGCTACTGCTGGCTCCACCTCGCTCTTCATCTCCTCGT
CCATAGCTCTTGCTCCGGTCGAATAAAGTGATATTGCAATTCCTCCCTGTTGGCAATTGTGGACTTTGTAAGAAACCTCAGGGTAGCCGAGATCAGTACA
GTGTACCGCTCGTCGGAGAACCTCACCAAAAGAATACTGCTCTCATTGTCGTGTTATCTAAAAATAGTCATCGGGATGCTTTTTGATCTCGCGCGCCAGT
TTATGTCAAAGTCTGAAACTTTTTGCATCCACAGTAAACGTAATTTAGAATGGCTGAGTTATGACGAAGGCATCGAAAATCATAATGGCAAAAGTGATCC
CGTTCAATTCACGAGGTGNNNNNNNNNNTATGCACTATGGACATGCACTTCCACTTTGAACGATCCACAACTGCAGAGAAAAAAAACTCGTTTCTTTCTT
CCCCTGCCCTTATGCTCTTCTTTATCAGGCTCGACCTATTCCTACTACGTATTCAACTCGTCGCCGCTCACTGTCATTGCACCCTAAATAGTCCATTGAG
TAGCTCAGCAACAACTTTTTTCGTCCTAGGGCCGGCGCTTGCCTCGTCTGTTGGACGAGTCCGTCTCCGATGCACGCTGCTGGGTATCCTGGTGCCCTGG
TGACTTCTTGCCGCTTGTTTGCGACTTTTTCCGCTGGATAAATTCCGTGGCAAACGCCGACACGCGAGGTGTCGAGCCCAAATACGCCGCAAGGTACTCG
CGAACTTCGCCAGGGTCTTCCACTGACGCACAGTATTCCAACAACGTCACGTTCGCGTCAACGTCGATCGTCTTTAACTGCTTCGAAGCCCAGGCCATGA
ACTCCGACGATACACTGTTCGATCCAAACGCGTTCGAGCTACCGACGCTGATGACAGACTCCTTGCCAGCCGGTTGAGCTGCTCCGAAGTTCCAGAACGA
CGCATCGTTCTCGGCCTTGGATGGGGGTTGCTTCAGTGCGCCATTGGTAGCACGAACTTGTTGACGGCTCTTCAGCACGGATGCGGGAACGGGACCCAAC
ACTGATCGGGACGGCTTAGGAACTGCAGCGGCCTTGTTACCAGCCACGATGTTCACCCACTGCGAATTGACCGGCGCATTCGCATTTGCCTTAGCACGCT
CCTGTGCCAACCGCTCTTCTTCGGCCAGAATATCACGCATTGACTTTGACTTGTCACTTGTTACGACAGCGGGAGGTTGACCCCACGGACCTCGTACAGG
TGAAGGGGAGCTTGGGGTCGGCACTGGCGTTGATGTTGCTGTCGACTTAGCTACCGTAACTTGTGGTACAGACACCGAAGGAGTGTTTATTGGTGTAACG
GCCATTGAATCCACACCCAGCATCATCTTTAACTGAGCCCCCATTTGCGCAAGATGCGCCGTATCTCCCTTGTCCCTGTTTCTCTTTTCAAGCAATTCGC
GCTGCTCTTCCTGCTGAATGGCCTTCAGCGACATCGACTTTGACGATGCCGCAGCAGGCGCCGTTCCAATCGCCCACGCGTCAGTTGCAACTGTATCGTT
TTCTACATGCTTGCCGTTCTTTTGTGCACCACCGGACTTGACATCCTTCTTCGTCGGCGTAGCAGACAATGCGCTCCCTGGCTGTCCGTGTTGTGCAGTG
GTTTGGTTGTTGTTACCACGAGATTCCTGTGCAGCACGATGCGTCGCCTCAACATGGATGTCGTGCGACGGCGGTGGCGATTGCTCTGGTACCTTTTGCC
GACGTGCCCATGCATCAGATATGGGTGCTGATCTGTTCGATTCAGGGAGCTGAGTCGAGTCTGGTGCTACTGGGCTTTTGGGTTGTGCTGATTGCAAGCC
CAAACCTGTGACGGTTTCGAGACCAGATAATTCCGGAGCAGGGTTTGGCCAAAACGCTTGTGTGCGTCTCTGCGCTTCATCGTTTACAAGAGCCGCGCTT
TGAGCAACGGGTGGCGCATTCTGCGTGTTCATTTGGTGATGGGTGTGGTACTCAGACCGGAATTGACTCTCCATGCCATCAGTCCTGAAGCTGTCGGTCG
ATGCAATATTGGCTTGGTTTCCACCGAAAAGACCTAACGCGCTCATTATACCTTCACGCTGGCTGAGTTGCCACGAATTTTGCTGCTGGTGTAAGAAAAA
TTGCTGTTGTTGCTGTTGCTGTTGCTGCTGCTGCCGCTGTTTTTCTTGCTGATCACGTAGAATCTGTTGCTGCTGATACAACTGCGTCTGCTGCTGCTGA
CGTGCAATTTCAAGCCGTTGCATCTCAATACGAATCTTCTCATCTTGCTCCAGCTGCAGCATGCGTTGTTGCTGCTGCTGTTGCTGGAGCTGCATCATTT
GTTGCTGGCGCTGCTGCTCGTGCTGCAGTTCTAGCAAACGCTGTTGCTCACTCAGAATGGGGTCCATACGAATTCCTCCGACACTATTCACGCGTGTCGA
CAGAGTGGCAAATGGAATTTGCCCGGGAACAAACTGACTTGCCAAGGCCGTAAATATGCCGTGCTGACCAAAACGAATCGGCAGGTGCGGCTTGAAGTAG
CCTGCTTCAAACCACTCCCGCATCTCGGCCGTTTTGAACGGTCCGCGCTGCAACCCTTGTGGGTCCAGGTAAAACCATTCGTCCGCCATCTCTACGCATG
ACGAAGGTGGCCCAGCAGAGCTTTCCTCAGCAGGCACTTGCGAAAACAAACGACTGCCTTTTTCTTCGAGCACAAGCTGCGTGTCAGCAGCAGGTTCCAG
CGCATCCAATAAATGGCTGCCACTTGACTGAGGCTCCGACGGATTTGCCGCGTGTTCGTCCGATAGTTTGTTGCCACCCTCAGTAGCCTTCTGGTCGTCC
GGTGTCGGATCGTCCCACGGCGTTTCTTCAGCATCGCTATCGTCAAACTGCCCAGCAGCCGCAGCATCCTCGAGTTTCTTGTCAAACGCGTCCAAATCGT
CCTTAATTTCCTCCTTTGAAAGCACAGCACGATATCAGGTCTTTCCCGCACACGGCAATTTCGACATAGCTGCAACACTTACCGGGTCCACCTTCGGCCC
CTGCAGCTCATCCCGCATCGCGTCCATCTCTCGTCGGAAAATTTCGGCAGCCTCTGCCATACTTGTCAAGTCCTACAATTCCCATCCAAGCACAACAACA
ACAAAAACAAAAACCAGCCCCAGCAACAGTCAGTACCAGCGAAACAAAGCCTTCGCTTCGTCAAACCACGCACCATTTCATTGCTGTCCGTGCCAGGCTC
CAAGACTTCGTCCCAAATACAGTCGCCTCGAGACGATGTTTCCGTGATCTTTGCACCGCGCTCCCACGTCGAGTCCCTCTCCTTGTGTCCCTGTCGAAGA
ACCCCGTCGTCCTTCTGCTGCGTGGCACTGTCCAGCGCCTCGTCTCCCCGTGCCCCCCGATCCTGATGTCCTCGAGTGCCTTGTACTGCTCCAGCTCCAG
CAGCAGTTGCATTGCTGCGTCCGCGCCCACGTCCGCGGTTGCGGTTGAGCGCCCACTGTTTGTAAATCTCTTCATAGTCAAACGGCAGCGTCGCCACGGG
CGGGAGACTGTGCTCTGACGCCACGGACGTCTCCACTACAAACGCCGGCAGCTCGTTCGTCGGACAATGGAGCGCCAAAAGCTCTTCTTTGCTGTAGCGC
AAGACTTTGGGCTTGCGTCGATCGTTCCGGTGGTCGTCGCCGCCCCCAAGGACCGCGTCTTTCATCGACAGCGGTCCAGTACTTGACGTTGTTGTAGCTG
TTGTTGTAGCTGTAGCTGTAGCTGCTGTTGAAGACGAGGACGATACAAAGCCTTCACCGTCTTTGGACCACTGGGGACGGTAAGCTGCTCCTTCCGACTC
GGTGCGGCCTCGTCCCTTCATGGCAAACATCGTCCGCGGTCGCAGCGAAATGTTGTTCGTAGTGTCGCTACTAGTGGTCCTACTGCTCGGGACAGTTGTC
GTACGAGTGGGAGACGTCGAATCACTCGTGCGACCGACTGCGTCCCCACTCGCCGAACCTTCTGCTACCGAAACAGCGGACGGCGGTTTCTTGCGGTGCT
TGTTCATCTTGGTGACGAATGCGTCGGTGTCGTGACAGGTGCTGGGGTTGGGGCTACTGCTCATGACTAAAGCGACGTCGCTCTCTCTCTCTCTCTCTTG
AATCTCTCGCTTAAGTTTCTATCTTGTCGTTGGTGATGGTGGGGGGTTGATGACGGAAGAGGAGGAGGGGGGGAGGTCTTCTTCCACTAAGTACGCTACC
TTCTCATTGGTGGAAAGTCGATTGTTTTGCCGTCATGACCAATGCAGGGCTGCGCAACTGGCGGTACGGCGCCCCTTGATGTCGCGTGGCGAAACTGACA
CTCCCTAAACATGCGCAAGTTGCCTCACGCTGTCCTTTCTGCCATTCGGTCGGTCTGTTTTTCTATCGTTTTTGTATGTGAAATGTAGTGGCGAGATCGT
TCCGTCGCGTGTTCCTTCTGCACCGTCTCACGGGACGCTGGACGAGTCGCAAGTGACACGCGACATCCAGTGGACAGCAGTGGACGTCAAGTCAAGTGAA
GAGACACAAGCGGCAGACGAGACAGTCAAGTCTGTAGCTGACGAGCGGTCGATGCCGACAATTGTATTGCAAAAGGACGAGTTTGGTCGGGATATTGAGG
TCGTTCTGGACAAGCACAAGCGCGACAAGGAGCAGAAATGTCCGCGTAAACGTAAACATAAGCGAGACAAACACCGACGAGATCGATCCAGGTCGTCGAG
TCCTCGAGATCGCCGTTATCGCACCCCGCCGCCGCCGGACCCGTTTCGTCCACAGGTATCATTTGATCGACAATTGTTGTACGGGTATCTTGTGTAGACT
GAAGGGAATTGACTTATCTTATGGTGGTGCTTGACAGATGGATGAACGTCGAGACAATCAGTCGAAGCGGAGGAAGCAAAGTCGAAGCAGGAGCCGTTCG
CGACGTCGAAGCCGCGATGACACAAAAGCTCACAGCAGATCGTCTCGACGTCGAGGCTCGTCCCGAAGTCGTAGCAGAAGTAGGGAAAGAAGACACCATC
GTAGAAGTCGATCACCTGCAACACGAGCCAGTCGATGGCGCTCATCGGCCTCGGGGGAGCGAAAGTGGACTCATAGTGCTTTTGATGATCGCAGTCCCAG
TCCGCCGCGAGCGCCTGATCCATTCTATCGACCGGAACCCGAGGCGTGGGTGTCGCGAGCAGGTGGCGTGTATGTGCCTCGGAAAT