Description :
From Genome Similarity Track
Location :
Scaffold_171:21709- 22815
Transcript NameFunction/comments
Physo_144175Arabinan endo-1,5-alpha-L-arabinosidase A precursor (Endo-1,5-alpha-L-arabinanase A) (ABN A)

Sequence
1106 bases(100 bases per row)
GAGCCTATACAACCGGCCACCCGCTGGAGAAGTCGATCTTGTTCCAACCGAAGCGCTTGTCACCGTCCGCATATCCAATAGTCGTGTTGACTGGAATTCA
CAAAGAACAATCGTGAGTGCATGACCAAAATAGCGCCGAGGTATCACATGAAGAAGACTCACCGTAGTGGTAGTACAGAACTGGACCATGAGCCGGGTCG
TCGTAGACGCCCTGGCCGCCGGGGCCAAAGACGTCGTCGTGCGATTCGAGCACAACGGTGCCTCCGTCCTTGGTGCAGTCCACGCCGTCCTTGTCCACGA
AGCCGCCCGTGGCCTTGGACGAGCGACACGCGAGAATGCGGTACTCCTTTCCTTTAGCCGGCATGGTCTTGTCGTAGGTGCAGCACTTGCCCTTGGACAT
GAAGAGGTAGTAGAACTCGCCGTGCTTGAAGATGTAAGGGCCTTCGAGCACCTCGAAGTTGGACGTGAAGCCGATCTGAGCGGGGTCAGAGCTAGATAGA
ATCGGCGGGTCGCGCATGTGAGACTGGTGGATGCCTTGCCAGTAGCTGCCGAAGGTCAGGTAGTAGCCTCCGTCTGCCTCAACCAGGTTCGGGTCGATAG
CGTTGTAGGGCTTGCTCGCGTCGCTCGTGATACCGGTAGATCCGCTGTCTTCCCACGGACCGTCCAGCGAACTCGAGCGGGCTACACCGATCGCGGAATC
CTGCGTGCCGAAGCTGCTCACTGAGTAGTAGAGGTAGTAGAAGTTGCCGGCCTTGTGTACATCAGGAGCCTGCAACCAGGACGTAGTTAGGGTTGAAAAC
ACTGTGGAGTACTACAGTAGATACCGGAACTTACCCAGAGATCGTATCGGCCCTTCAATTCGATGCTGGAGCCGGCCGGAAGCGCAGGGCCTTTAAACTC
CCACGGCCCCGAGATGTCCGGCGCGGTGTGCACCGAGATGTTGCCGCCCGTGGAGAAGCGGTAGTACGTTCCGTCGGCGCTCTGGATGATGGACGGGTCG
TGCGCGTTCGTGCAGCCTGTGGAGCATGCGCCGGGGGCGGCGTATCCGTTGACGCCAGTTGCTGCCGCCAGGAGCGGGAATGCTGCGAGCCACGAGAGAG
TCTTCA