Description :
From Genome Similarity Track
Location :
contig_43:217078- 218484
Transcript NameFunction/comments
g7499.t1hypothetical protein

Sequence
1406 bases(100 bases per row)
GTCCACGTCTGTCTTGCCGGCTCGGAGCTGCTTGATGATGGCCTTGAGTCGGTTTACCTGCTCGCTTTCCGAGTTCTTGTTGGCGTTGTTCGTGATGAGC
TTCACGCGCGAGGCGTACGTGAGCGACGTCACAGTCTCTTCCTGCAGAAATTGACACGCGCGTGAACATGTTGAACAGCGTAGTCACTCACGACAAAGCC
AAGACGTGCAGTCATACCTGGTTGTAGTCGGCTGGCGAGATGTTGACGAACATGAGCTGCCGGATCAAGACACAACAGGAAGTTAGCACCTTCCACTGTC
CAGAGCTGATCGATTCGGGGTTACCGTTTTGGCATTGCCACCGAGAGAGTCCTGCATCAGCTGCGTCAGCTGATCAAGTGGCAAAGGACACAGAACAATG
TAAGCTCAGTTGCTGCAAGATGCTGCGTGGAAGTCGCTGCTGGTACCTTGTTGTTACGGTACGGGATGAACTTCTCGTTGGTCGACAGTGCCGAGATCAC
GTCTCCTAGCGCTGCAGCCACAAGAATGGAATGTGAGTGACGGAAGACTAGTCCAAGTTGCTCTCGGAACTTACCGCTGAGACTCTTGTTGATGGCTTGG
GCCTCCTTGAGGCGGTCGGCTGTTGCACCAGTTTTACCAGCGCGCTCCGACCCGGCAAGATCGACGAGGCTGAGCTTGCCGATCGTGGTGGCCTTGGTGG
TTTTGTTGTAGCTTTCCACCAGCAAGGAGAAGATGGAGTGACTGCGACTGCTCTCGGCGTTCATCTTGGTGGCACCGACTTGGCGCTTCTTGTTGGCAGC
CTCGAACAACCTCAAGGTTTGTTCGGGCGAAGTACACTTCTTGAACGTGGCATTCTGGACGACGACCATGCCCTTGTCATTCTTCTTGATCTCAAGCTTC
GTGTCGTGAGCTCCGCCGCCTTCCATGAGGTGGAACAAGTCGATGAGAGTGTCGTTGTAGAGCTCCAGCATCGTAGCCTGGAAGGAAACAGCGAAGTTGG
CCTTCACTTCGTCAGCCAGCGCGAAGAGATGGTGGATTGTTCGTGGACTCAACCCTGGATCGCGCTCGACTCCTGTCATGGTGAAGGTTTTGCCCGATCC
GGTCTGGCCGTACGCGAAAATGCAGACGTTGTAGCCGTCCACGGCGCTCTGAAGGAGATTTTTCGTGTCCTCGAAGACCTGTACCTGCGTGCTGGCGGGC
GAGAAAACCTGGTCGTACGCAAACGTTTTCGCTGCTCGGCTGCCTCCGCTCACTTCGAGCGAGAATTCGTCGAGAAACTTGACACACGGAGCACACCCAC
GCTCATTCTCTGACCCACTCATGGGGCGACAGCGAGCGTAGACGCGGATTTTGCCCTTCATGTCTTCGATCTGGTTGTAGTACTTCTTCCGCAGTGCCTG
CTCTTC