Description :
From Genome Similarity Track
Location :
Scaffold_76:21706- 22959
Transcript NameFunction/comments
Aphas_H257_15310tau-tubulin kinase, putative

Sequence
1253 bases(100 bases per row)
ACGTCGGCCTCCCTCCGCCGCTGGAGCGCCTCTACCTTCCTCCTCTGCTCGGCCTGCCGTCGCTCACCAAACGACTGGATCGTGGGGGGTCCCGCCGTCG
CCGCCACATTGAGCCGCTTCTCGAGCTTCCAAATACGCTCCTGCATCTCCAGGCGTTCATGTGTGGGGCTATCGAGCTCAAAGAAGGATGCGTAATGCTT
GGCGAGCTTAAGCAGCATGTCCGGCGGCATCACGCCCTGCCCCAGCGCCCGAACCCACTTGGACGCCCGCTCACTCGTGTCCTCCAGAGCATCCCACTCC
TGCACCAAACTCGCTTCGTCATTGGCGTCCTCCACGGCCCTCACCGCCTTGCGGACAAGCGCGTAGTTGGGTGCGTCGAAGTACGACAGACCCTTGAGGT
GCTCCATGATGGCGAGGAGGTGCCGCGCCCCCGGCAGCCCCTCGAGCATCTGCTCCGGGTGTGTCTCGGTGAAGTACTCTTTGAGCGCGACCACCACCTC
GCGATTCTTCTTTTGCGCGTCGTGGGCCCACGGTAGTTCGCCGCGGATAAAGTCGAGCACGAGGTACATCCATGACCATAGGTCGTCGCGCCGCCCGAGG
TCTTCCCGCCGGTGCGCGGCTAGTGACGCGTACATGGACGTGCCGCGGAACTCGGCCTTGTCCCGCGGCGGGATTGGCAGGCCCTGCGGGTCTAGATGTT
GTTTGGACAAGCCAAAGTCGATGACAAAGTAGCGCCTGATGATGATGATTTGCATGAGATGGAATAGAAGGGAGAAGACGGCGACGAGCGGATGGACGTA
CTTGGGGTCCTTGCCGTTCGAGAGCGCAAAGTTGGACGCTTTGATGTCGCGGTGGAGGTAGCCGGCGTTGTGGAACGCTTCGAGGCAGTCAAGCATTTGG
ATGGCGGCGGAGATGCACTTGGGCAGCGGGACGCCGTGGGTCGCGTCGGGCTGCAGACGCATCTTGGACATGTTGTCGCCCAGCAACTCCATGATCAAGA
TGAAGTTGTCGCCGTGCTTGCCGTGGTGGTGGTACTTGCACACGTACGGATTCTTGCGCTGCAACGCCACAAGTACCTGGCTTTCCCATTCCAGCACAGG
TTTCATCTGGCTCGGTGCTTCCACCTTCACAGCCACCTTGTGCGCCGGGTTGGTCAAGTCGAACGCCGTGTAGATCTGGCTGAATGTTCCCTCGCCAATC
TTCTCGACCACGCGCCATCGACCGAGCAGAATCTCGCCGCTCTGTCCACACAC