Description :
From Genome Similarity Track
Location :
Scaffold_35:217036- 224560
Sequence
7524 bases(100 bases per row)
GTCTTCTTAAGCGCGAAAGTTACTAGCGCTGATGTCGAGGCCGTGGATCTGTCTCGCATCAAATAATGGAATTCGATGACGAAGACTTGTCTCGCCTGAC
AAGTCATTCACAAGCTTTTCTGGTAACACCCAAGGCTTGTTTTCAGGGGCTAGACGCAGCACATTGCCGTCTAGAGCCTCCTGCGTGGTACCAACAGAAG
CCTTGGTACCACTTGGATCGTCATCACGACGGTTCAACTCATCACCGCATTCGCTATACGGCGAATGCGCAGTAGCAGGCGCGGGGGATGAGTCAGCATG
CTCATCCTCCAAACTAAACAGACTCCAATAGTGACCATGAGTCTGACTACCCGCTCAAGTCCTATTAGTAGGCTCTTATTCGGCCGCCACCATCGACTCG
GGTGACCTAGATGTCTTCTTCGAGTCGGACCCACCGTCCGACTCCCCCGAATAAATAAGCCCCACTTGGGAGCCATCATCATTAGCACGTGGTGAGTCAC
CACGTGCATATGCAGCAACTGGTGCTGCAGGAAGAGTTGCAGCGGCAGCAGACGAAGCATCGTCTACCGCGAGAGGTTGGGCATCGTCAAGAGCAGCTGC
GTTCAAACGCGCAGCTGCTTTCTCAGCAGCTTTCGCCGCGCATCGCATGGAGTTTTTCACCATGCGATGAATATGCAGAAATGAATGGATCAGACCAAAA
AAAGTGCTCTCTGTCCCTGATGTGGTCAACGGTGACCACATCAACATGATAGTGATTGAGTGACTATCGTTTAACGGAGGGGGGTGATGTAACGGGGTGA
GCCTGTTACATCTAATTAACCCTTGATACTTGTTAATTAGAATATTATCATAAAGGTCGATAATGTTCGTGAATATTAATATAAGGGGTACTATTAAGAA
CATATTAAGAACACTCACCGATTGGCTGATATGAGTCACTATATCAGCCAGCTCTAGCGGTCCAATCAAAGATGGACGCGCGCAATGAGTGGTGAGCAAG
ACTCTAGCATACATTTTTGTAGATAAATATAATTAAGTTAGGACTAAGACATAGGTTAATGATTAGGACTTAATTATATTTAATACAGTTTTACTTTTAC
CAACAACTGGACTGTCTCTAGTTGTTTACCTTCCTCTGCACGTTTGCTTAGATGGAGAGAGGCACCACTAGCACTGCTGTCGGTGATAGTAGCTCCACAC
TGGTTGTCCAGTGTGTTGCTCCGGTGCCCCGTTACAAAAACCCTCTTTATTTGACTCACTACCCCTACTTTTGCTCCTTATAAGAAACACGTGGCACATG
ATGTGACAGTTGTTCTAGCCAGAAAATTGTTAGAACCTCAAGCCGAGTCAGCAACGTCATAGGACCTCGGACGTGACCTAATGGAAAGATGTAAAGCATG
TCATAATTTGTGGGCTTGTGATGCACTATTTACTGATGAAGTCATGACGACAAATTCAGCAGACAATTAATAATAATTTAGTAAGGGAATAGATAGGGAG
AAGTACTATTTAGTTTTTATAACTACGCCACTGATCCAACACGTCCATCCAGGAAATCTTACCTCTTGTCGACATCAAACCTGTGCGACCATTAAGTTCA
GCTTAGCGAGTATATCTCTCACCAAAGCAAAAGTACAAAGTATTTCACCACTGCAAAGAAAGCCCAAATATTGCTAAAACGAAGTGCAGACGTATATAAG
CATTCAGTTGTAGCACCGCATAAGGGAATCAACGGCGCATCGGTTCATGGCCATAAAAGAAACAAAGTTTGAGGGATAAACCTTAAAGTGAATAAGAATC
GACGTGTGAGGCATCCTGAGTTCATGAAGGAGCTGTCGATATTCATTCACGGCGCGATAGCGACATGCTATCCGAAGATCTGGTCCTGAAGAAGCAGACC
GACTGCGAATAAGCCACGATATCGAATATCATAATCTTACATTTTCCAAAGGCTGGCTCCAGAGTCTTAAGGGGAAGAACAATATCAAAAGATGCGCGTT
GACCGGAGAGAGCGGGAGCTTATGTACAAAGGAAGTGCAAGCAGCAAAGTATGGAATCCGATATTCGATCAAGTATTATTCCAAATGATGTTTCTATCTG
TAACGAGACAAAATTATTTTACGACTTACCACCAAACAAAATCCTCTACGGATCGAAACAGTGGCGAGAAGTGCGTAAAGATACGGATGACATCTCTCTT
CGCTGCGACGCAAGTGGTTCTTAAAATATGGAGCCCTTGATAATCGGAAAGGTTAAAAACCAAGGTGCTTTAAGGGTGTAGAGATCGAGAAGGGTGGCAA
CGTATACGCTGCAAACTCAAATACCTGCATGACTGGAATAATCTTTGATAAGTGGCTGCACCAATTTAACCTTGGATTGCATGGTCACATAGAACTGCTT
CTTCTCTATAACGATTTCACTCACAAAGTCCGACGAGAGCTCAACAACATCACGGTGGTCTTTTCCCGCCTAACATGACTTACACAATCCGACCGCTCGA
CGCAATTACGCGGTAATACATGATTTATATATGCACACCTATATATGGTAATAAGTATCATCCAATTTACTAAACGCTTGCTACAAGAGACTTCATATGC
GATAGCGCATCCATCTGATTGAAGCAAACATGGAATGCAGACTTAATGTCCTCGAATCCATTGAGTTTGCAGCTTAGAGCTGGAACACTATTTTTGGGGT
ATTCATTCGAAGTTTCTGGATCAAGAGTGAGATCATCGAAGCGCCACAGATTGCGAATTATCGTGCACAAGTGATTATCGAAAGTCTAGCCTCGCCTTCC
AACAAGACTGCTGCGATCTGGCTGATATGATTAAAGTTCTAAGGTTAAGTTTTAGCGTGTAGGATTATGTCGTGATCAAGGACCACGAGCAGATTCATGA
CGAACAAGAGGCTCTTTTGTTTAAGCAGAAGCGGAGCCCGCAGAAGTAGAAATTGACGAAGATCAAGCGCTTATCAGTACAAAAGAAGCACTTAAGCGAT
GCCTGATTTGGCGTTTGTACTTCGTACGCTCATATAGAGACACGCGTATCGTTCAGTCAGATCTGGATATGATTTCATCAGATATTCGTAAGAACCAGCA
CGCTAGAGCGAAAAAGATCAATATGAATGATCTCATATAGTAAACAAACGTTACATATCATTACATATAGGGACATGTTCTGTAGCGTTACTTAAATGCC
CCAATATTCAATTTTTTAGTCTTTATAAGATCATGCAACTAATGTCTTACATATTCTCTATAAGAGAGTTTATATAAGACACGCTGTAAAAATTGGGCAC
AAAGTTGTCTTTTAAAGAGGGGTGAGTGTAGTAACATGTTAAGGCAAGGCATCATTGCGATCTTGAACTAGAAGAAGGGTGTAGCTAGAATTTTGCTCTA
TTTAATTATAGAAACACGCAACAGAAAAGGCTTGCACCGCCTTCGAGGCAGTGGTGTGCAGTTGTGCCAGAAAGTTGAAGTAGCGGCACTAGTGTGCGCT
ACGAACACTAAGGGTGGGAACGCTTGCTATCGGCAATGGTGCTAACGACGTCGCTATAATTCAGCGTGCTCATGTTTCCGTTGATATCTCGGGCCCTGTA
GTTATGTTGTATATACGCAATTTGCACCATGGCCACTCTAATCACAAGCACATGGCTTTTTTGTTGGGTACATGTTCATTAAAAATATTGTGGTGGTGCT
AGTGCAGCACTTTAACCAGATTTGCACGGACTCCTCCGGCCAAATATAAAATGGTATATTACGACTTCAACTTTACAACATCTGCTACAGTTCCCTTCCT
ATCATCGTTCCGGGTTTGATACGTGTAAACTGTTGTCTAGAAAGAGGTGAAATGGATAGATAATTTATCATTTACTTGACAATTCCTGATTTTGGTTTGC
AGCTCATTCGCATATATGACGCGTAAAATAAAAGTTTTGTTGTGCTGTTGGATATTGAGTATGACGTAGATTCTCTCGAGATTCCATGAAACCGAATTAT
TGTATACCACATGGTCTGAGTCAGATCGCGTATTCAATATATATTATCATCCATACCATTATGAGACGCAGTGTGACAAAAGGATGGAAGTAAAATTAGT
ATTGAAGCGAAATTTATTTCGGACGTATACATAAATTTGATTTACAGAAGAGAGCTGATAACGAGCCTTCAGTTTCCATTGATGAGCCTTGTATGCATAT
ATAGGATGGGAGAGCGATTCTGGAGCTCGCCCTTTGATGTAAGTAATTTACCCCTGGACTGGCTACCGCCCAGAGATTCCAGTAAATAGTGGCAATCCGG
TCGGGGATATGTTGGCCCCTGCCGAAGGGGCATTCTCGGATCGTCAGTTCAGGTAAATGACTGTAACGTACCACAAAAAAGTAGTTCTGTTCAAGGAACT
AAATCAAGTTCTATATATTTACGTTCCATTCTTAGTGGTTAGCGGCATGGAAGTGGGCTGTGTTTTGTGTGCTAACGATGAGAGTGCTAATCGATCGTTG
TGTGTTAAACGTACTTGTTGACGTTATTGACGTTCCGAAGAGAACAACGAGAGAATAGAATACGAAGGATGGTATTGCTCGGTAGTGCCGTCTACCACAA
AATGCGGTCGATGGCATACAATTTATTCACAATATAGATAAATAATATTGAAGGAATTTTAACTACTACCGAAGGTAAAAGGTGACCATAACCTCTTACC
ATTACAATCAATTCAGCTCGAAACCACTAACACTTACTGTTTGCAAAAAGGGCAAGAATTTCGCTGCCCCCGTGTACCCAGCATTTGTTTGTTAGCCCTC
TGTCCACCCTTAATCAAATTTAGCCAATCATCTGTGGGCCTTGGCGTGAGGATTATCACACACTTGGCAGTCGCAATTAGTACCCTAATTAAAGTGTGAC
ACCTACGAGAAAGGGACAGGCGCTATCGCACTTAGTACGACATTTAAATACACCTGCGTTATCCACATCCACATACAGACACATACAGTAAGTAGGTTTT
GAATGTTCACCGTTCACCTTGTGCACAGTCACTAATACCTTCACCCTTGGATTCGCAAAGATAGGGGAGCAAGCTCTGGAGCTCGCCCTTTAATATATGT
AATCCAGTTTGGAGAACTGAATCAAGTTGCAAAACACTATACATAAGCATTCACTGAAGAAGAAGTATGATGCTGGTAATGTCTGTATCAACCTAGTACA
GTATACTTAGGCAACGTGATCGGCCTTTGCTTATAAGCGTCCAGCATTTGCTTATGGATATAAATATCATCATTGATCGATTTAAGCCAATCACAAGCGT
GCACCGCAATAGTAGCCTAGCCAAAGAGCGACTTCGGATATACCAATACCTACAGGGGGGACAGGCTAGATCGCACTTAGTACGGGTAAGGTACACCTAA
CCACGTTATTTACAGACATACAGACACACAGACACATAAATAAGTACGATTTAAAAGTTTGGCATACAACCTTGCGCACACTCACTAATAGCTTCACCCT
TCGGGCTCGCAAAAAACAATAAATCAATTGAAGGGGCTTCTTCTGCCACCAATAGAGGAAGGTAAACTAAAAGACGTAATCTGTTAGTTTACCAAGTACT
TTCGATGAAATTTACTTCACATTTACTGTTTGCTGGAGGTGTGAGACTTTCGCTGCCGGGGCGTTAACTTTGCTTATTTGCCGTTTATTCGCCTTTGGTC
ACTTTTGAGCCAATCATGTGCGGGCATTAGTGTGCGTGTGTGTCGAACACTAAAAATGGTGACCTGATCAAAGAGTGATACCTCGAATCCATACCTACCT
ACGAAGGGGGGACATGCTACATTGCACCTTTAAAAGTCCGGTGTGTATATACACCTAGCGCTACGTACAGACACAAAGACACACGGACAGAAAATCGGTT
TCGAATACTCGGCATTCACTTTGCCCGTAGTCACGAATAGCTTCATTTCACCCTTCCGGCTCACAATGAAAGAAATCGGCTATCACCTAACGCACACTCA
CTAGTGACTTCGCACTAGGGCTTGCAATACGTCTATGATTGGGAAGCAAGCCATGGAGCTCGCCCTTAAGTAATTCAGTCCATAGAACTGAACCAAGTTC
TGTAAAAACCACACACCCATTCCGGTTGGTGGACGACTTGGGAATGGGTTGTGCGCTGTGTATCAAAAAAGAAAGTACAGATACTTCGTTGAATGTGAGA
GGTATTCGTTGATGTTGTTGACGATCTAAGGAGACGAATATGAGAAAAGTGGTTGATAAAACTGCTTGGTAACGCCGCCAGTAACAAAATGTGGCCGATG
ACATATATTTGACTCATTCATAAGAGAAATCTAATGGACGGAGATTCATCTGCCATCGACAGAAGAAGGCTAACATAAATTCTTGATATATTATTTCGTA
GAGTACTCTATATAAAAAACACTTGCCATATACTGTTTGCTGGAAGTGCGACACTTTTGCTGCCATGAAGTGTCGAGTTTTTGCTTGTTAGCCATGTGTC
CGCACTCTCTTTAAGCCAATCATGTGCGTCATTGGTACGTGTGTGACGAGCACTGAACATGGTCGCAATTAGTGACCTATTCAAAGAGTGACACCTAAAG
TGCACATCAACCGATGAGGAGGGACATGCTACATCGCACTTAGTGCGACATGAAAAAACAGCTGTGTTACTCACAACACAGACAGACACACAGTCACACG
GACGGACGGACAGACAGAAAGTAGGTTTTGAATGCTCGGTATTCACCTTGCGTACAGTCACTAATAGCTTCATCCTTCGGGCTGGTATATATATCTACTA
TTTATCTCGAACTCGATAGAATCTTGTCGAATCTTGCTCCCCTACGCCTCAATACTGTGAGAAAATACATATAATACCGCACGTTGTCACTTAGTGTTTG
CGCAACTAACATGTGTAAACTAGAAGATCGTGATACATACTTGACAATCATGTCATTTGAATAGTCGCTGCACCGGCAAGATCCTCGTGCTTGCACTTGC
ATTTGTTTAATCGAGACGAGACGAAATTCGCAGAATCAATCGCTATGGTCACGATACCAGTCACTGGAGCCAAACCACGAGCTTTTGAAGTTCTTGGTTT
CATCACTGACTGGTTGTGGTTTGCAAAGGTTCGTGCAATCGTATCTGTACCGATCGACTCGTTACCGAGTACGTCAGTGTTGAAGAGCTTTGTGAATGCA
TCCAACTTTTTGGCGGCGCTTCCGCCAATCGGTTAAAGTTCTCATTACGTACCTCTATCTCCGTGGTGCCACGTGCGGACGATGGTGTCCCATGGTGTGC
ACTTGTCAGTGAGGTACCTAATGAATGAACAAGCACGTTTTTATCCATGAGAGTGGCTCCTTTCGAGGGAAAATGTCGTCACGTGTGTCGGTCAAGGCCA
ACACGAGAGTGATGGACAGTCTATTTTCAAGCTCGCTTTGTAGATACTGTGTGTGAATGGGTGCGTGATCATGTAGCTGCGACGACGGGTTTGCTGAAAA
GACAGACAACTGATGATGCGCTAG