Description :
From Genome Similarity Track
Location :
Scaffold_35:217025- 224847
Sequence
7822 bases(100 bases per row)
TGTAGATAGAAGTCTTCTTAAGCGCGAAAGTTACTAGCGCTGATGTCGAGGCCGTGGATCTGTCTCGCATCAAATAATGGAATTCGATGACGAAGACTTG
TCTCGCCTGACAAGTCATTCACAAGCTTTTCTGGTAACACCCAAGGCTTGTTTTCAGGGGCTAGACGCAGCACATTGCCGTCTAGAGCCTCCTGCGTGGT
ACCAACAGAAGCCTTGGTACCACTTGGATCGTCATCACGACGGTTCAACTCATCACCGCATTCGCTATACGGCGAATGCGCAGTAGCAGGCGCGGGGGAT
GAGTCAGCATGCTCATCCTCCAAACTAAACAGACTCCAATAGTGACCATGAGTCTGACTACCCGCTCAAGTCCTATTAGTAGGCTCTTATTCGGCCGCCA
CCATCGACTCGGGTGACCTAGATGTCTTCTTCGAGTCGGACCCACCGTCCGACTCCCCCGAATAAATAAGCCCCACTTGGGAGCCATCATCATTAGCACG
TGGTGAGTCACCACGTGCATATGCAGCAACTGGTGCTGCAGGAAGAGTTGCAGCGGCAGCAGACGAAGCATCGTCTACCGCGAGAGGTTGGGCATCGTCA
AGAGCAGCTGCGTTCAAACGCGCAGCTGCTTTCTCAGCAGCTTTCGCCGCGCATCGCATGGAGTTTTTCACCATGCGATGAATATGCAGAAATGAATGGA
TCAGACCAAAAAAAGTGCTCTCTGTCCCTGATGTGGTCAACGGTGACCACATCAACATGATAGTGATTGAGTGACTATCGTTTAACGGAGGGGGGTGATG
TAACGGGGTGAGCCTGTTACATCTAATTAACCCTTGATACTTGTTAATTAGAATATTATCATAAAGGTCGATAATGTTCGTGAATATTAATATAAGGGGT
ACTATTAAGAACATATTAAGAACACTCACCGATTGGCTGATATGAGTCACTATATCAGCCAGCTCTAGCGGTCCAATCAAAGATGGACGCGCGCAATGAG
TGGTGAGCAAGACTCTAGCATACATTTTTGTAGATAAATATAATTAAGTTAGGACTAAGACATAGGTTAATGATTAGGACTTAATTATATTTAATACAGT
TTTACTTTTACCAACAACTGGACTGTCTCTAGTTGTTTACCTTCCTCTGCACGTTTGCTTAGATGGAGAGAGGCACCACTAGCACTGCTGTCGGTGATAG
TAGCTCCACACTGGTTGTCCAGTGTGTTGCTCCGGTGCCCCGTTACAAAAACCCTCTTTATTTGACTCACTACCCCTACTTTTGCTCCTTATAAGAAACA
CGTGGCACATGATGTGACAGTTGTTCTAGCCAGAAAATTGTTAGAACCTCAAGCCGAGTCAGCAACGTCATAGGACCTCGGACGTGACCTAATGGAAAGA
TGTAAAGCATGTCATAATTTGTGGGCTTGTGATGCACTATTTACTGATGAAGTCATGACGACAAATTCAGCAGACAATTAATAATAATTTAGTAAGGGAA
TAGATAGGGAGAAGTACTATTTAGTTTTTATAACTACGCCACTGATCCAACACGTCCATCCAGGAAATCTTACCTCTTGTCGACATCAAACCTGTGCGAC
CATTAAGTTCAGCTTAGCGAGTATATCTCTCACCAAAGCAAAAGTACAAAGTATTTCACCACTGCAAAGAAAGCCCAAATATTGCTAAAACGAAGTGCAG
ACGTATATAAGCATTCAGTTGTAGCACCGCATAAGGGAATCAACGGCGCATCGGTTCATGGCCATAAAAGAAACAAAGTTTGAGGGATAAACCTTAAAGT
GAATAAGAATCGACGTGTGAGGCATCCTGAGTTCATGAAGGAGCTGTCGATATTCATTCACGGCGCGATAGCGACATGCTATCCGAAGATCTGGTCCTGA
AGAAGCAGACCGACTGCGAATAAGCCACGATATCGAATATCATAATCTTACATTTTCCAAAGGCTGGCTCCAGAGTCTTAAGGGGAAGAACAATATCAAA
AGATGCGCGTTGACCGGAGAGAGCGGGAGCTTATGTACAAAGGAAGTGCAAGCAGCAAAGTATGGAATCCGATATTCGATCAAGTATTATTCCAAATGAT
GTTTCTATCTGTAACGAGACAAAATTATTTTACGACTTACCACCAAACAAAATCCTCTACGGATCGAAACAGTGGCGAGAAGTGCGTAAAGATACGGATG
ACATCTCTCTTCGCTGCGACGCAAGTGGTTCTTAAAATATGGAGCCCTTGATAATCGGAAAGGTTAAAAACCAAGGTGCTTTAAGGGTGTAGAGATCGAG
AAGGGTGGCAACGTATACGCTGCAAACTCAAATACCTGCATGACTGGAATAATCTTTGATAAGTGGCTGCACCAATTTAACCTTGGATTGCATGGTCACA
TAGAACTGCTTCTTCTCTATAACGATTTCACTCACAAAGTCCGACGAGAGCTCAACAACATCACGGTGGTCTTTTCCCGCCTAACATGACTTACACAATC
CGACCGCTCGACGCAATTACGCGGTAATACATGATTTATATATGCACACCTATATATGGTAATAAGTATCATCCAATTTACTAAACGCTTGCTACAAGAG
ACTTCATATGCGATAGCGCATCCATCTGATTGAAGCAAACATGGAATGCAGACTTAATGTCCTCGAATCCATTGAGTTTGCAGCTTAGAGCTGGAACACT
ATTTTTGGGGTATTCATTCGAAGTTTCTGGATCAAGAGTGAGATCATCGAAGCGCCACAGATTGCGAATTATCGTGCACAAGTGATTATCGAAAGTCTAG
CCTCGCCTTCCAACAAGACTGCTGCGATCTGGCTGATATGATTAAAGTTCTAAGGTTAAGTTTTAGCGTGTAGGATTATGTCGTGATCAAGGACCACGAG
CAGATTCATGACGAACAAGAGGCTCTTTTGTTTAAGCAGAAGCGGAGCCCGCAGAAGTAGAAATTGACGAAGATCAAGCGCTTATCAGTACAAAAGAAGC
ACTTAAGCGATGCCTGATTTGGCGTTTGTACTTCGTACGCTCATATAGAGACACGCGTATCGTTCAGTCAGATCTGGATATGATTTCATCAGATATTCGT
AAGAACCAGCACGCTAGAGCGAAAAAGATCAATATGAATGATCTCATATAGTAAACAAACGTTACATATCATTACATATAGGGACATGTTCTGTAGCGTT
ACTTAAATGCCCCAATATTCAATTTTTTAGTCTTTATAAGATCATGCAACTAATGTCTTACATATTCTCTATAAGAGAGTTTATATAAGACACGCTGTAA
AAATTGGGCACAAAGTTGTCTTTTAAAGAGGGGTGAGTGTAGTAACATGTTAAGGCAAGGCATCATTGCGATCTTGAACTAGAAGAAGGGTGTAGCTAGA
ATTTTGCTCTATTTAATTATAGAAACACGCAACAGAAAAGGCTTGCACCGCCTTCGAGGCAGTGGTGTGCAGTTGTGCCAGAAAGTTGAAGTAGCGGCAC
TAGTGTGCGCTACGAACACTAAGGGTGGGAACGCTTGCTATCGGCAATGGTGCTAACGACGTCGCTATAATTCAGCGTGCTCATGTTTCCGTTGATATCT
CGGGCCCTGTAGTTATGTTGTATATACGCAATTTGCACCATGGCCACTCTAATCACAAGCACATGGCTTTTTTGTTGGGTACATGTTCATTAAAAATATT
GTGGTGGTGCTAGTGCAGCACTTTAACCAGATTTGCACGGACTCCTCCGGCCAAATATAAAATGGTATATTACGACTTCAACTTTACAACATCTGCTACA
GTTCCCTTCCTATCATCGTTCCGGGTTTGATACGTGTAAACTGTTGTCTAGAAAGAGGTGAAATGGATAGATAATTTATCATTTACTTGACAATTCCTGA
TTTTGGTTTGCAGCTCATTCGCATATATGACGCGTAAAATAAAAGTTTTGTTGTGCTGTTGGATATTGAGTATGACGTAGATTCTCTCGAGATTCCATGA
AACCGAATTATTGTATACCACATGGTCTGAGTCAGATCGCGTATTCAATATATATTATCATCCATACCATTATGAGACGCAGTGTGACAAAAGGATGGAA
GTAAAATTAGTATTGAAGCGAAATTTATTTCGGACGTATACATAAATTTGATTTACAGAAGAGAGCTGATAACGAGCCTTCAGTTTCCATTGATGAGCCT
TGTATGCATATATAGGATGGGAGAGCGATTCTGGAGCTCGCCCTTTGATGTAAGTAATTTACCCCTGGACTGGCTACCGCCCAGAGATTCCAGTAAATAG
TGGCAATCCGGTCGGGGATATGTTGGCCCCTGCCGAAGGGGCATTCTCGGATCGTCAGTTCAGGTAAATGACTGTAACGTACCACAAAAAAGTAGTTCTG
TTCAAGGAACTAAATCAAGTTCTATATATTTACGTTCCATTCTTAGTGGTTAGCGGCATGGAAGTGGGCTGTGTTTTGTGTGCTAACGATGAGAGTGCTA
ATCGATCGTTGTGTGTTAAACGTACTTGTTGACGTTATTGACGTTCCGAAGAGAACAACGAGAGAATAGAATACGAAGGATGGTATTGCTCGGTAGTGCC
GTCTACCACAAAATGCGGTCGATGGCATACAATTTATTCACAATATAGATAAATAATATTGAAGGAATTTTAACTACTACCGAAGGTAAAAGGTGACCAT
AACCTCTTACCATTACAATCAATTCAGCTCGAAACCACTAACACTTACTGTTTGCAAAAAGGGCAAGAATTTCGCTGCCCCCGTGTACCCAGCATTTGTT
TGTTAGCCCTCTGTCCACCCTTAATCAAATTTAGCCAATCATCTGTGGGCCTTGGCGTGAGGATTATCACACACTTGGCAGTCGCAATTAGTACCCTAAT
TAAAGTGTGACACCTACGAGAAAGGGACAGGCGCTATCGCACTTAGTACGACATTTAAATACACCTGCGTTATCCACATCCACATACAGACACATACAGT
AAGTAGGTTTTGAATGTTCACCGTTCACCTTGTGCACAGTCACTAATACCTTCACCCTTGGATTCGCAAAGATAGGGGAGCAAGCTCTGGAGCTCGCCCT
TTAATATATGTAATCCAGTTTGGAGAACTGAATCAAGTTGCAAAACACTATACATAAGCATTCACTGAAGAAGAAGTATGATGCTGGTAATGTCTGTATC
AACCTAGTACAGTATACTTAGGCAACGTGATCGGCCTTTGCTTATAAGCGTCCAGCATTTGCTTATGGATATAAATATCATCATTGATCGATTTAAGCCA
ATCACAAGCGTGCACCGCAATAGTAGCCTAGCCAAAGAGCGACTTCGGATATACCAATACCTACAGGGGGGACAGGCTAGATCGCACTTAGTACGGGTAA
GGTACACCTAACCACGTTATTTACAGACATACAGACACACAGACACATAAATAAGTACGATTTAAAAGTTTGGCATACAACCTTGCGCACACTCACTAAT
AGCTTCACCCTTCGGGCTCGCAAAAAACAATAAATCAATTGAAGGGGCTTCTTCTGCCACCAATAGAGGAAGGTAAACTAAAAGACGTAATCTGTTAGTT
TACCAAGTACTTTCGATGAAATTTACTTCACATTTACTGTTTGCTGGAGGTGTGAGACTTTCGCTGCCGGGGCGTTAACTTTGCTTATTTGCCGTTTATT
CGCCTTTGGTCACTTTTGAGCCAATCATGTGCGGGCATTAGTGTGCGTGTGTGTCGAACACTAAAAATGGTGACCTGATCAAAGAGTGATACCTCGAATC
CATACCTACCTACGAAGGGGGGACATGCTACATTGCACCTTTAAAAGTCCGGTGTGTATATACACCTAGCGCTACGTACAGACACAAAGACACACGGACA
GAAAATCGGTTTCGAATACTCGGCATTCACTTTGCCCGTAGTCACGAATAGCTTCATTTCACCCTTCCGGCTCACAATGAAAGAAATCGGCTATCACCTA
ACGCACACTCACTAGTGACTTCGCACTAGGGCTTGCAATACGTCTATGATTGGGAAGCAAGCCATGGAGCTCGCCCTTAAGTAATTCAGTCCATAGAACT
GAACCAAGTTCTGTAAAAACCACACACCCATTCCGGTTGGTGGACGACTTGGGAATGGGTTGTGCGCTGTGTATCAAAAAAGAAAGTACAGATACTTCGT
TGAATGTGAGAGGTATTCGTTGATGTTGTTGACGATCTAAGGAGACGAATATGAGAAAAGTGGTTGATAAAACTGCTTGGTAACGCCGCCAGTAACAAAA
TGTGGCCGATGACATATATTTGACTCATTCATAAGAGAAATCTAATGGACGGAGATTCATCTGCCATCGACAGAAGAAGGCTAACATAAATTCTTGATAT
ATTATTTCGTAGAGTACTCTATATAAAAAACACTTGCCATATACTGTTTGCTGGAAGTGCGACACTTTTGCTGCCATGAAGTGTCGAGTTTTTGCTTGTT
AGCCATGTGTCCGCACTCTCTTTAAGCCAATCATGTGCGTCATTGGTACGTGTGTGACGAGCACTGAACATGGTCGCAATTAGTGACCTATTCAAAGAGT
GACACCTAAAGTGCACATCAACCGATGAGGAGGGACATGCTACATCGCACTTAGTGCGACATGAAAAAACAGCTGTGTTACTCACAACACAGACAGACAC
ACAGTCACACGGACGGACGGACAGACAGAAAGTAGGTTTTGAATGCTCGGTATTCACCTTGCGTACAGTCACTAATAGCTTCATCCTTCGGGCTGGTATA
TATATCTACTATTTATCTCGAACTCGATAGAATCTTGTCGAATCTTGCTCCCCTACGCCTCAATACTGTGAGAAAATACATATAATACCGCACGTTGTCA
CTTAGTGTTTGCGCAACTAACATGTGTAAACTAGAAGATCGTGATACATACTTGACAATCATGTCATTTGAATAGTCGCTGCACCGGCAAGATCCTCGTG
CTTGCACTTGCATTTGTTTAATCGAGACGAGACGAAATTCGCAGAATCAATCGCTATGGTCACGATACCAGTCACTGGAGCCAAACCACGAGCTTTTGAA
GTTCTTGGTTTCATCACTGACTGGTTGTGGTTTGCAAAGGTTCGTGCAATCGTATCTGTACCGATCGACTCGTTACCGAGTACGTCAGTGTTGAAGAGCT
TTGTGAATGCATCCAACTTTTTGGCGGCGCTTCCGCCAATCGGTTAAAGTTCTCATTACGTACCTCTATCTCCGTGGTGCCACGTGCGGACGATGGTGTC
CCATGGTGTGCACTTGTCAGTGAGGTACCTAATGAATGAACAAGCACGTTTTTATCCATGAGAGTGGCTCCTTTCGAGGGAAAATGTCGTCACGTGTGTC
GGTCAAGGCCAACACGAGAGTGATGGACAGTCTATTTTCAAGCTCGCTTTGTAGATACTGTGTGTGAATGGGTGCGTGATCATGTAGCTGCGACGACGGG
TTTGCTGAAAAGACAGACAACTGATGATGCGCTAGAACGTGCTATTCTTTTGTCTACCAATATATATGTTAAACTCTTGCTCACCACTCATTGCGCGCGT
CCATCACTGATTGGACCGCTAGAGCTGACTGATATGATGCCCGTGTCAGCCAATCGGTGAGTGCCCTAAATATTACCCCTTATGGTGATATTCATGAACA
ATCATTAACTTTCATGATAATATTTTAATCAACAAGTATTGAGTGCCAATTAAATGTAACAGGCTTACCATGTTACAAATCTGACCGGCGACCTTGTGTG
CGAGGCTGCTGGGAAGATTCTT