Description :
From Genome Similarity Track
Location :
Scaffold_680:21701- 22893
Transcript NameFunction/comments
Phyta_totarag10138hypothetical protein PHYSODRAFT_525100

Sequence
1192 bases(100 bases per row)
caacaacagcatcgcCCGTCTTCAGCCAGCCAAGATCCTTGCCGGTTTCCGTGGCGCGGTACAGGATCGAGTCCGTGCCGATCATCGAACCCACGCAGCG
AGATACAACGCCCTTCACGAAGCCCTCCGTCTGGCGAGCAGTCTGCTCCAGagccgtcagcaccagcacaggCATCTGCGGACGGTACTTCGCCACTAGA
CGAGCCGTGTTGCCCGtctccgtcagcaccaccagcatcttcgcgTTGATGTCGATGGCCGTCTTCACAGCCGACGACGCAACGGCCTCAGCCGTCTGCA
TCGGGCCGttcacctccagcacggcgttgCGCAGCGACTGGTACACGTCGTTGTAGTGGATGGCAGTCTCGGCCTGCAGGCACGTCGCAGCCATCACCTC
CACAGCCTGCACCGGGTAGTCACCGTTGGCAGTCTCACCCGAAAGCATCACGGCGTCCGTGCCGTCGAGCACAGCGTTGGCCACATCCGTGCACTCGGCA
CGGGTCGGGCGCGGTGCATGGATCATCGACTCCAGCATCTGCGTGGCCGTCACCACGGGCTTGCCGGCCAGGTTGGCCTTGCGgatcatcatcttctgcg
CAAGGAACACCGTCTCAGGCGGGATCTCCATGCCCAGGTCACCACGGGCCACCATGATGCCGTCCGTCTTGGCCAGGATCTCGTCGAAGTTCTCCAAGCC
CTCGTGCGACTCGATCTTTGAGATGATCTTGATGCCGCGGCCACGGGGGCCAAGCACCTTGCGGATGTTGACAAGGTCGTGGCCCGTGCGCACGAACGAA
GCGGCGATGTAGTCGATGCCGTGCACCAGACCGAAGTTCAccaggtcgtcctcgtccttctccgtcagcGTCGGCAGTAGCACCTTGCACCCGGGCAGGT
TCATGTTCTTGCGCTCGCCCAGAGTCGCCGTGTTGTTGGCACGGGCGACAATACCGTTGTCCTTGATCTCCGTGaccgtcagcaccagcgagcCAtcggc
caccagcaccgagcCACCAACCTTCACGGACTCGGGCAGCTGCGGGTACGAGCACGCAATCTTGGTCTCGTCACCGAGGAACTCGTAGTCCGTCGTCAGC
TCAATGAGCGAGTCCTTCTGGATCGTCACCTTGTCGTGGTTCTTGAGGAAACCCGTGCGGATCTCGGGGCCCTTCGTGTCCAGCATGATGGC