Description :
From Genome Similarity Track
Location :
Scaffold_66:21700- 24335
Transcript NameFunction/comments
Hyaar_Emoy2807578hypothetical protein

Sequence
2635 bases(100 bases per row)
TTCGTTAACTATGCGATGAGATAGGTGAATGGTTTGGGAATGGACCAACAAGAGCTTCCCTGTCCTAGAATAACTTAATGGAGTCACTCAATAATCGATC
AGTCACTTACGTGACTGATGGTTAGGGGGTGGGGGTGTAACGGGGTGACTCCGTTACATGATATTTTACATAAGGTAAATATCAAGTATGAATGTTATGT
TAAGACCGACATCATAGTCTCTCAATATTAGCTTAACAAGTAATGTTGTGATTCAGAAGTAATACACTGTTCATCGGTTGATATAGAGCAATGATATCAA
CCAATAAAGCCGAGGCACGACAGAAGAACGCAATGAGTGGCGAGCAGATAGTTACAATACATGTTTGTATTTAGATATAGTTAAAAGAAGACTAAATATG
ATTTATCAACAGGAAATTAACTATATCAAATACAGTTCTACTTTTACCCTTGTCTCGTTTTGAAATGTTCCTCTGCACGATAAGGGTACGTGAGATTCCG
AGGCACCTGCTTACCCTGTGTTCAGAGTAAGTAGCTTGTACTGTGACAGTACAAGCGATCGGTCCCCCGTCACATAGCGTATGTGATACAATAATACACC
TGTCAGTTTTACTGATCTCTTTATGTGTGTATCACACCAGCATATCTGGCTACGACAACCGTTTGTGTAGCCCACTACACGCGAAGTAAGTCGAAGTGAA
CGGAGTTTGTCCGGCATTCTTGACACAATAAACTAAGGAAAAGTGTGCTATGCATACGAGAGTAGCTGAATCATGGTAGCGCATAATATAGGTGTTCGTG
CTTGCGCCAGCAAATGCGCGAAAATAAGATCCCGTGACGATGCTTTGCGTGTTTGGAAAGACTATAAACGTGATTAGTCCACAAGTGCCGATGATATGAA
CATATGCACTTGGCGACTAGTAGTGGTAACTCCGTTTACAGATGCTGCCGTTTATCTGGTTTTCTAGCTCGTTACCGATTAAATGAGCAGATAGATCGCT
TAATCATACATATTAGCGACTTAGGAAGGTCGCGTTCGTTTCCATTCCAAACACGCAAAGTATCGTCACGGTATCGTATTTTCGCAGCAAACGCGCGAAA
ATACGAACACCCACATTATGCGCTACCATGATTCAGCTACTCTCGTATGCATAGCACACTTTTCCTTAGTTTATTGTGTCAAGAATGCCGGACAAATTCC
GTTCACTTCGACTTACTTTGCGCATCTTACAAAATACAAGTATAAAAGAATGTATGATGACCCTGAACATTAAACAAATATTTCTTTTTACTTAAAATTT
TATGCTTGATGTGGCCGTATACTTTTTGACCGAGTGCCAAAGCGGCTTTTTGTATGTGGGGCTATGCCGCCAACGCAAAAAAATGGGACGTTAACACATG
AGGGGTGTGTTAACGTCCCATTTTTTTGCGTTGGAATAAAGCTTTGCACATAACATACTCAAATAACAGCGCCCAACTCGTACTTATTAGAGAATTTGAG
TAAAAACATGGGTGGTCGTATATTTATGGCCCGGACTGTATTGGAAATAAAACCGAATAAACCTGATTTTGGCAGCTACGAGGCTGTCGGGTTAAATAAA
ATTCAAATAAAACCGATAGTAAAAACCGCTTGGTGCCAGCCGATCTCCCCCGAATCCTATCCACTACTTCCACCACCAACTCACTCATTCACTTTCAAAA
GCGATTGTACGAATATGACCACACAGAGGTTTCGTGGCTACAACGCCACTGCCGAGCACGAGCTCACTTCGCTTGAGAAAGTGCTCCTTTGTATCGCTAA
CGAGGCCATTGCATGTCTCAAGGTGCTCAAGAGACACCTCTCGGACTTCGACAATCGTCACGGGAACCTCTTTACCAACACGGCCGCCTCGTACCTGCGG
AAGGATTTGCGCACGGCGAAAGACACGGCACTCAAGTTGAAGCACGTGGCGCATCAGATGAAGCACAACTTGCAGCTGGCAGAGGCGGCTACCGACTCGG
CTCGAACCGTGATGGGGGTCATTGCCAAGGCCATGGACGTCCTCAAGACGACGGCGCACCAGTACGACGAGGAGATTATGAGGCAGTCCAAGAAGAGCAA
CGCGGACGAGAAGTACCACACGAGTCGGTCTTGTGAGATCCGAGACCAACGTAGAGATGACCGACACTGCGGTCCCTTGCACGGGAGCAATTCTACCACG
AGCAATGACGTCGCTATTGGTGGTAGTACAGCTGCTCTTCTTGAGTTTACGGACACTGTCGAGCAGCTGGTCAAGACAATCCTGCGCGACAACTTCAACA
TCAGTGCATTGAGTCATCAGATTACGATCGCCGAGAAGTCGCTGTCGTCATCGTCTGCGGCCGTCGAGCGTGTGAAGATGGTGGTTCAAGACGTGGAGGA
AAAACTCGGAGGTGGCACACCGAGTGCTGAGTCAGGTTGCTGTGCGTGAGAAGCGTCTACTATCGCCCAACTGTTCATTAGAATATCGTCTCACTGTCCG
TGTCTGCAAGTGGATAAATAGTCGACGAGAATCTCGATGCCGCTGTCCAAATACGATGGATACCAAAGTGGCAAAATGGTTCATTGGATAATGCTTGACA
AGTCTCGGGCCACGTCAAGTGTTGCTATCAAACTG