Description :
From Genome Similarity Track
Location :
Scaffold_425:217- 2424
Transcript NameFunction/comments
g11606.t1POM58197.1 Phosphatidylinositol 4-phosphate 5-Kinase (PIPK-D12/GPCR-PIPK) [Phytophthora palmivora var. palmivora

Sequence
2207 bases(100 bases per row)
ATGGGGGCGTACGAGGCGCTGGCGCTGGCCCAGAGCGCGCAGCTCTACCTGCTCGTTGGACTGCTGGGCGTCGTGGTGTACCTGCTGCTGGTGCTGTCCT
ACTTCCTTGTGCCTAATATCAAGGCGCAGCACCCGGCCGCCGACCTCGTGGTGTGGCACGCCGGCTGCGGCTTCATGACGTCCGCGGGCTTCGTCTTCGC
CTTCGCGCTGCAGCGTCAGGACGTGGACACGGCGCTCGTCCAATGGCAGTGCTCGCTGCTCGCGCCCTACAACCAGTTCTTCTTCCTGGCGGGTGCCTGC
TGGTACCTCATGCTCACGCTGGACCTGCTCGTGGCGCTCGTGAACCCTTGGATGGGCTACAGCTGCAAGTCCTGGGCCTACCACACCATGTAAAGCGCGT
CTAATGAACCCGCTGAGAGTTGAGTCGCTCCATAGGACTGACTGTTGCTCTGTTGCTGCTGCAGAGTCTGGAGTGTGAGCGCCGTCTCGGCGCTGCTGCT
GCACCAGCTCAAGCTCTTCGGCCTCTCGCCGCTCAATGTCTGTTGGGTCAAGCGCACACGCGACCCGATGCAGGTCAACACGGCCAATTGGGTCTTCCTC
TTCGCCGTTGTAGCCGCCATCTGCGTGCTCTCGTTCGCGGTGCTGCTGTTCGCGAGCTTCCGCTTCGTGCGCCGCCAACTGGACGTGACGTATCGCGCCA
AGCGCCGCAATTTGATGCAGTACTACCGCTACCTGCTGATTTTTGCGGGACACTGGGCGGCGTGTGGCGCCTTGTACTACGCAGCGTATCGCCAGCATTT
TGACGGCAAAATGGCAAAGCACTTTGAGCTCGCGTTCGCGCTGGTGTTTGGATCGTACCCAGTGTTGCTGCTCATCGTCTGGGTGCTGAACACGGAGCTG
TACCAGAATTTCTCCAGCGAAAACAATCTGTCCAAGTCGGAGCGAGGAGCTGGGGACGCGACGAGCACGGAACACTTCAGCGCCGCCCTCCGCAAGGACT
TGATGCGATACACGACGGCAGGAATTCGATGCAGCATCAGCGAGTCTCCTGCTGACAGCCTGCGCTCTCCGCTGCTGAGTCTGACTCGAGATCGCTTTGG
GTCGTTGGACCGCTCTGCTGCGCTGTCATTTCTGCAGATGGAAGAGGGTGGTTCCGCAGGCTTGTACCACGAGAAGAAGCGGTTGGCAACCACGGTGTAT
AACGGGGAGTATCGCTATTACGAGAAGCTTGGCTTCACGGACTACGCGCCGAAAGTGTTTCAGAACATCCGCGAAATCTGCGGGATCGACAACGAAATGT
ACGAGCAATCGTTCGCTGATACGCTCCTGGAGCGTGCATCCGAGGGCAAGTCCGGGATGCTTTTCTACTTTACGAGCGACCGCAAGTATCTGGTGAAGAC
GATGACGAAGAAGGAGCATTCATTCCTGCTTGAGGTGCTGCCGCTGTTCCACCAGTACATCCTGAAGCAGCCAAATTCGCTCTTGTGCCGCTTTCTTGGC
TGCCACTCGATGCAGCTGCCCGTGGGGTGGAACAAGATGTTTTTCGTCGTGATGGAGAACATTTTCCCGGATGGTCCGGTCGATGAGCGATACGACCTCA
AGGGCATCTTCCACCAGTCCAACTTCCGGTACCAAGAAGGGGTCCCAACGCCCGTGTCGAGTGACTGGAGTCGGAGTGGAAGGGAGGAAGAGGGCGTCCT
GCGTATACATGACGACGACGAAGCAGCATCGAGCGATAGCCAAAGTGTGGACAGCGAATTGGGACACGTGACGGAAAAGCAACCGCTGCTGCGTCGTGGG
AGCTCGCGTCCGTCGCTCAGATACGACAACGACTTTGTCACACAACGAGCCTCACTGCGAGTAAACCCCACGACTCGCGCGAATCTACTTGCGCAGGTGA
CAAGTGACTGCGGGTTTCTCCAGGAGTTGGGGATTATGGACTACAGCTGTCTGCTCGGCATCCGCCATTACAACCATCGCATTGAACCCGAGGTTATGGA
TAATCTCGCGCACAATGCCGTCGTGGCAGCCGATCAGTCCACGGTGTACTACCTCGGCTTTGTGGATATCCTGCAGCACTACAACATCGGGTGGAAAATG
CAGCACTGTTTGCTGGCTGCGGTGGTCGACAAGCGGCAGATCACGGCCCTCCCTCCTGCTGAGTACGCGCTGCGCTTTTTGAACTTCATCCACGAGTATC
TGCTACG