Description :
From Genome Similarity Track
Location :
Scaffold_1113:217- 2127
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1113-snap-gene-0.4Cysteine dioxygenase
Pytar_ATCC12531maker-par_contig_1113-snap-gene-0.5Ankyrin repeat protein

Sequence
1910 bases(100 bases per row)
CGCTCGCACAGATAACTGATCCAAGGCCATATATACTGATCTACGCCACCGTACCATGATTGTCGTTGGTGGCGCTTTTTGTGGGGAGGCAGTTCCAAAC
GTGAGGACTCGGCGCTTTTGTTCTGACGGTGCGCTCCCCCGCAGAACTGTTTCGCTTCTTTAGCACACACCTCGGTCCGGTTCGCCAAAAGGCTGACCGG
TTCACCTGCATCGTGTTTTGGGAATCTGTACCATATCACTAAAAGTAGTACAACTCTCAGTGCGCCAGTCGACGAACCGGCGATTCTCATTGGCTGTCCA
CAGCATTCAAAAAGCTCCGGAAAACGTTGCGCTGCAGCAACACGCCAACCGATCTTGTGGACCGAACCGACCAGTGGAGCGGCCGCCTACATTGCGTTCC
GCTGGACACGGCAGTTGCACTTGCTCTCGTGTGACTGCGCGCGTCACCCCTCGCTTTCCCTGGTCGCGTGTGCGTGCCCCCGGGCCCCACTCCCTCAGTC
CGCCCCGCTGTTGGCACAACACATTCCCGTGCGACCATCCATCTGAACCCAGGCTCCTCTCTCTCTCTCGTGGACGGCCATGACGCACGAGACCATCGCT
TGCTCGCTCACGGGTTCTGCAGATGCGAAGACCAACGTTGTCGACGGCAAGCAATCACCAGCGCGTGTGCACCGCGTGGCCGCTTCCAACCAGGAGGAAC
CGCCCTGTGTGGAGAACGCACTCACGCTGGCGCAGCTCGTCGAGGCCGTGGAGATGCAATTGAAAGACGACAGCAAGACCTCGTTGAACAAGCGTACAAT
CTTCCGGTCGCTTCTCGAGTGAGTGGTTGCCCTCCAGCGTTGACGGTCTCTGTTTCATCAGTTAACTAACTCCCATGTATTGTACATAGACGCTTTGATG
GCAACATGCGCGACCTCGAGAGGTTCGCGTACGTGGACTCGTCCAAGAACTACACGCGCAACCTGATCTCAACCGACCACGATACGTACGCACTCATCTT
GATCGTGTGGAACCGCGGCAAGTACAGTCCTATCCACGACCATCCCTGCGACGGCTGCTGGGTCAAGGTGATCGACGGCACAGTCAACGAAGTGCAGTAC
CAAGTGCGCGGCAACGCCCTCGTTGAGACCTCCAACATCATGCTCAGCGAAGGTGTGACGTACATGGACGACGCAATTGGTCTCCACAAGATTGGTAACC
CGCGCGATGACGTGGATGCGATCACGCTCCACTTGTACTCGCCACCGTACGAAAAGTGCCGCGTTTGGTTCAATCCGACGAATGCTGCTGAGAGCTCGGT
CGCGTACGCATACTACTTCTCCGAATTTGGCGAACGCGCCGACTACTAGTGGATGTATCGCACACCCATTATGATACCTGGTATGAAAGCAATGTATCGA
TCATGATATAATGTGCGAGCCCACTCTTGCGAGAAGCTTCACAGAGCCAGCCCATGGAGGGACGGGCGGCGCTGGTTGGACGAAGGGCGATGTGTCAGCG
GGGCGTCATCCCCAAGAGGATCGACAAACCCAGTGGTGGGGCGTCCGGAGCCCATCTTGAACGACCATTGGCGCTTCACGGCCACGGGCGGTTGGTACTG
CGCCCGCCCATAGGAAGAGCCTGGTCGCGAGAAGGCAGAGATCTGTCGGCAACAGAGCGAGGATTAGGCAACCACTGAGACCCGCTGAAGATGACTATGA
AGTCTCATCGTACGCTTTCGGATTTGTTGGTGGTGTCCGCTCCCTGCTCGGGTTGGTCCTGGATCTTGCGGATGATGCCCTTGGCGATTAGGTGCGACTT
TGCACTCTTGCTGCATCCCCTGGCTGTGATAAGGCAACAACAAAACCAGTGTCAGTGAGCTAAAGAACGACCGCAACCCACAACTCTGGCTAGGTCTCAC
CGGCAAAGAA