Description :
From Genome Similarity Track
Location :
Scaffold_3391:217- 1298
Transcript NameFunction/comments
Phyag_g13221helitron helicase-like protein

Sequence
1081 bases(100 bases per row)
CTGCCTAATCAACTATACCACGATACACAACATTCAATAGACAGTATCCGCTCTCCTCTCGGTGAGCATTATAGTCCACCGCAATCTTGACATGCTGCCT
TGATGTTGATCGTGAAAGCACGACGTATAACTGGCCATGAGCAAACACTGGTTGCGGTAAGTATACACCAAGCTCTCGTAGCGTCTGTCCTTGAGCCTTG
TTAATAGTCATGGCAAACGCCAACTGAACCGGGAACTGGCGTCGGTGAAGCTCAAATGGAAGGCCGGAGTTGTGTGAGGTCAATGGGATGCGTGGGATAA
CGACAATGTTGCCGGTGAGGATTACTGTCAGCACTTTGGCTTCGATGTCGTGGTCGTGCATATGGCGCACTTGAAGACGTGTTCCATTGCACAGACCGCT
TTCGCCGTTGATGTTTCGGAGTAGTATGATCGGAGCACCAATCTTGAGACAACGCTTGTGTGGTGGCATTCCGGAGACACTTAGCGAATCCAGAAATTCC
TCAGGGAACATTGATGTGTCCGACCCTTGCGCGTCTTCAACCGTGTCGATAGAGACGTATTCCTTGGCCTCTCCTGGCAATGTTTCTATCGCTGAATTAT
TGAGCTTTAACACATCGGCATTCAGCGACGACAGAATTGCTCTGGTTGCGAAATAGTCATCTTCAAGATATCTCTCCCCGAGGTCATCGCATACGTGATC
GATAAGGGCCTTCGCCTTTTCCACGCCGTCTGGAGCCGTCAATATCATGTCTTGTTGAATCCTCGTGTAGTCTCTGCCTCTCTCGGAGCGCCCTTCATTA
CGtccttcaccaacacgcaGTAGAAAGTTTGCAAATGTTCGGGTCTCCATTGCGGTTGTTCCATCCACCATGCCCTGAACTCTCATGTTCGTCTTGAGAT
GGAGTATGTCAAATTTTGCCCATAGCGACGATCGCTTGATACAGCTGTTGACTACTTGGCCGGGCGATCCATGGGGAATCGCAGGAAGGAGTTGACGGTA
GTCGCCTGCCAGCAACACCATTATTTCACCGAAGGGTttgtcgttcttcatgaGATCCCGCAATGTGACATCCACCGCCTG