Description :
From Genome Similarity Track
Location :
contig_43:216942- 218439
Transcript NameFunction/comments
g7861.t1hypothetical protein

Sequence
1497 bases(100 bases per row)
TTTAGCTGGTCTGTGGTGGGTGGGAGCTGTTGTTTTACCACGTGGCCTGGTGTTGCTGTTGTTGTTTAGGTTAGTCGACGACCCCTTCCAAGTCCACGTC
TGTCTTGCCGGCTCGGAGCTGCTTGATGATGGCCTTGAGTCGGTTTACCTGCTCGCTCTCCGAGTTCTTGTTGGCGTTGTTCGTGATGAGCTTCACGCGC
GAGGCGTACGTGAGCGACGTCACAGTCTCTTCCTGCAGAAATTGACACGCGCGTGAACATGTTGAACAGCGTAGTCACTCACGACAAAGCCAAGACGTGC
AGTCATACCTGGTTGTAGTCGGCTGGCGAGATGTTGACGAACATGAGCTGCCGGATCAAGACACAACAGGAAGTTAGCACCTTCCACTGTCCAGAGCTGA
TCGATTCGGGGTTACCGTTTTGGCATTGCCACCGAGAGAGTCCTGCATCAGCTGCGTCAGCTGATCAAGTGGCAAAGGACACAGAACAATGTAAGCTCAG
TTGCTGCAAGATGCTGCGTGGAAGTCGCTGCTGGTACCTTGTTGTTACGGTACGGGATGAACTTCTCGTTGGTCGACAGTGCCGAGATCACGTCTCCTAG
CGCTGCAGCCACAAGAATGGAATGTGAGTGACGGAAGACTAGTCCAAGTTGCTCTCGGAACTTACCGCTGAGACTCTTGTTGATGGCTTGGGCCTCCTTG
AGGCGGTCGGCTGTTGCACCAGTTTTACCAGCGCGCTCCGAACCGGCAAGATCGACGAGGCTGAGCTTGCCGATCGTGGTGGCCTTGGTGGTTTTGTTGT
AGCTTTCCACCAGCAAGGAGAAGATGGAGTGACTGCGACTGCTCTCGGCGTTCATCTTGGTGGCACCGACTTGGCGCTTCTTGTTGGCAGCCTCGAACAA
CCTCAAGGTTTGTTCGGGCGAAGTACACTTCTTGAACGTGGCATTCTGGACGACGACCATGCCCTTGTCATTCTTCTTGATCTCAAGCTTCGTGTCGTGA
GCTCCGCCGCCTTCCATGAGGTGGAACAAGTCGATGAGAGTGTCGTTGTAGAGCTCCAGCATCGTAGCCTGGAAGGAAACAGCGAAGTTGGCCTTCACTT
CGTCAGCCAGCGCGAAGAGATGGTGGATTGTTCGTGGACTCAGCCCTGGATCGCGCTCGACTCCTGTCATGGTGAAGGTTTTGCCCGATCCGGTCTGGCC
GTACGCGAAAATGCAGACGTTGTAGCCGTCCACGGCGCTCTGAAGGAGATTTTTCGTGTCCTCGAAGACCTGTACCTGCGTGCTGGCGGGTGAGAAAACC
TGGTCGTACGCAAATGTTTTCGCTGCTCGGCTGCCTCCGCTCACTTCGAGCGAGAATTCGTCGAGAAACTTGACACACGGAGCACACCCACGCTCATTCT
CTGACCCACTCATGGGGCGACAGCGAGCGTAGACGCGGATTTTGCCCTTCATGTCTTCGATCTGGTTGTAGTACTTCTTTCGCAGTGCCTGCTCTTC