Description :
From Genome Similarity Track
Location :
Scaffold_11:216824- 222738
Transcript NameFunction/comments
Phyke_g1537hypothetical protein PHYSODRAFT_354835
Phyke_g1538conserved hypothetical protein

Sequence
5914 bases(100 bases per row)
ACATTTTGCCAATTGTTGATCGTCTTCAACATGAACGGCGTTGAAGGATCAGCAACGTCGAGATCTTTGGGAATGTCGTGTTTGAGGTGTGTAGATGCAT
CCTCGCAGTTGAGACAGCCACCATTATGCTTCGATACCGTTCCGCAAAGGATCTTTCTTACGCTGCGTCGCTTTACTAGTAACACCGTTGACACACTCTC
TAGTTCATCATCAGTGAGTCTTGATTCAAGGCTCACTGCTGTAGACATTGGTCAGAGCTCCGGCAACATGTCGAGAAATGCACGAAATAGAGCGATTTTC
CAAGTGTGGTTTAGCAGCGCGTCATTGAAACTTTTGAGGTGAGACGGATGAAATCCACTGTCGATACAGTTGATAGTatcaagttgaaggcgaaCTTTCA
TCGGTTCAACCATGAACTCCATCACGCACACCAGAAGAACCATCGCTGTGAACAACTAGGCCAATATCACCTGCGCTTGTCAATATCATTGACGCATCGA
GCAGTTCGCCTTTCATTCGGGCATAATTTCGATTAAGCTTACTGTGCATGCCTGTAGTAGTCAGGCTACCCTGCATAAACTTTTAATACGCATTACATCA
ATCAGCATTTCGCAAGTTGTTTCTCGTCAAGAATATATGGCGTTCGACTGGAAGGACAGTATCTGATTTCCTATGCACGCACGCACGCACTGCCAACGAA
CGTTTTAGTCGATCCACATGTACGAAATCCATTCATGGTCTCGAGTAACTTGCATTGCCATGTGCTGGCCAAGGCGCACAATATGAGGTTGAGCTACAGC
CCGGTATGTTGATTCATCATTGTTGAAGAATCACATTGGAAGAGAAACTACCATCTGTGGGGGCAGGTGAAAGCTTCCCAGTAGGTCCAGGCTAGGTAAT
ATCACCAAGCTTTCGCTAACGGAGTCTCGCTGTCGGAGAGAGCGGTGGCGGCTTCAAGCGTCACAATCGCCACGAGGCTTTCTCGTGATGATCAGCCTTT
GCTACTTCGACAGGCGGGGGAATGAAAAGACGCTCCACCGGGTCAATCAATAGCAATACACTGCGTTGAATGCAGACTTCTCTTCTTACGAGATCAACTC
GAAGTCCCCAAAGAAATGGTCACTCGTCACCACGCGAAGGATCCGCCTTAAGCTCTGTTGGCAGGAATACAGCAAGCCAGTTCGTGTGATCGAGGATTAA
TTCTTGGCGGCGCCTAATACCAGCTGCTTTAATCGGAAGCGCCAGAAACGAGTCGGTTGCTGCAAGATcggctgcaactgcaacgcTTCACGTTCTGACG
ACTCCCGATTAAGTATATTTCAAAATCTTACTTTAATTTTCTGATGGTCTAGTTAATTTATTCGAGAGTCCTCTGTTCGTATTGCGGTGGTGATGGCCGG
ACGCAAGGGTATTCGTGTCACAAAAAAATCGAGGTAATGGTGCAACAGCCGTTGAGGAAAGTTCGCATACAGGGCGTCAGTGATTTTCCGCTACCCTTTG
CAACCCGCTGCCCTCGACTCGGGTAAAGGCCAAGCACGCAACGCTGACGTCCAGAGGGTGCCTCTCTCTCCCGACTTCTTCTCTGGTTCCGAGAGAGCCA
TTTCCGGTTTGGCGTCGCCTCCCTCCTATTAATCCTACACCAGTCAGTCGAGAGAGACAAAGCTTTCTCGCTGCTGTTACCTTAAAGACAATCAACCTAT
AGTATCGCCATGGTTGTAGCCAGGAAGGTGctcatcatcgtcggtgtACTGGTGGTCATCGGTGTAGCTGTCGGCATCATCGTCGGCGTCACCAGCGGTG
GCAGCGATTCAAATACCACCAGTGACCAGTCCGGAACCTCTACAAACTCTGGCTCTGGCAGTGGGACCGTGTCGGACTCAACGTCCAAGTCTAGCAACGC
ATCCGagtcgtcgttgctgacCAACAGCACGTCAAGTGGCAGTGGATCTGCCACCAAAGAACCTACCAGTGATCCAGAAGAGGCCAAGGCTGCTTTAACG
ATGCTTGCAATTGGTGACTGGGGAGCCACAACGGACAAGCCTGGCTCGTGCTGTAACAAGTACCGCAAGGTCGCGAACGACTCTCTGGAGATGAAAATCG
ACTACTGGGCTCAGATCAACATCGCTGAGATCCTGGCCCAGGCTGCAGGTGACATCAAGCCCTCGCGTATCATTGGCCATGGTGACAACATCTACTGGAA
CGGTGCCGGTCCCGACGATATTGATTACCGCATGGAGGCGACATTCGAGAGTGTGTACGACCAACCGGAGCTTGAGGGCATCCCATGGATCAACGTTGTG
GGCAACCACGATCTCGGTGGCTCTGAGTACATCTGTGGTGACAAGGACTACAACTTCCGCGAATGCGAGAGCACTGATGAGTTGCTCAAGTACTTGAACC
TCAAGTTCtctctgcagcaggagtATAAGAGCGCCAACAGCGACCGCTGGAAACTCTCGGACCACTACTACGTCGAGAGTGTAGAAGAGAATGGAGTTTC
TGTGGACATCTTCAACATTGATACGAACTTCGCCGACTCCCACGGTGTAATGCAGatttgctgccagtgctACGGATatgtcaagaagaaaaatctGTCG
GCTGCTGAGGCCAAGGCTCTGGGAAACACGTGTAACGACCGCACCCCTGGTGATGAACTTTGCGCCGGTGGCAGCACCGAGATGTACACCGCATGCGCTG
ACACGATCGAGAAGTGGTGGAACGACTCGTtggagcaggtgaagaaggacttgGCTGCATCAACTGCGACTTGGAAGGTTATTAACTCGCACTACTCACC
GCACTTCCACATGAGTGaggacaagatgaaggagtgGTTCATGATCACGAAGGAGGGCGGTGCTCACCTCTGGCTGAACGGTCACACGCACGGTTTCAAT
CACGACATCAGTAACTGGGGCACGCACTTCTACGAGaacggtggtggcggtggtaTCCAGAGTGAGACGTCGGGCATGCCTCCTGAGGTGGCTGAGAAGT
ATGTGGAGCACGCGTGGATTGCTGCGGGCAACCCGTATGGCTTTTTCATGCTGCACTTCTCAGAGGACTGGCTCAAGACGGAGTTCGTCACGTTCGATGA
CTCGTGGACGTTCAGTGTGAAGAAGGATGAAATCGTCAAGGGTGGCTACCAGAAGGGCCACTGCTGGCATGTTCCTGTGACCATTGGTACAGGTAAGGAG
TGCACCACAAGCCAGAACAGAGTATAGGCTCGCGTAAACTCTTAAAAAGACAAGAGACAGCGTAGGGCTGTGTATGTATATGTAGTTACGAGGGACCAGC
TTTTAAGCTGGTCTCCGTTTTGAGACTTCAATACAGATTATACTGAAAACATGACGTTTCTTTGGTCTATCGCCATTAAATACTTGGGATTTGTGTGGTT
GTTTGTTTGAGTCGTGGCTatcctgctgcagttgttggcGCCTTGCAAGAGTCATGTATATGAGTACGTCCTTCAGAAGTCGCTGTACCAGGACTGGGCA
GCGAACTGCCAGATAGACCATTGGCTATGCGATGATCCGGGTCTCGATGGCGCTGTACTGGCTGTTGGTCTTTGTCTATACCTGTGCGTTGTGGCTTTGG
TTCGGGGGAATTGGCTGGGACTGATTCATCGATTGCCCCGTTGATCGCCTTGGGTGTGTCTGAAGTGCAAAGGCCCCCTCCGTTAGATCCAAACCCGAGC
TCTTCGTGACCGCCATTGGTCGGGTTATTTTCCACGTTCGCGTTCATCTCTTCTCCTGGAGGCTCACACTCTGAAAGTAGctgtggttgttgctgctgca
ttttttCGCAATTCCGTTGTTGTTCGTCGTCATCTAAATACTGTTTTCCCTGTGTTTTCTCGCCCTCAAGCACgtccaccttcttctctaAAGAATCAAC
CTGTTTCTGCAGTCCATCCACTTGTTCCTCTAAAGTCTTCACCTGCTGACGCAGCTCCTCATTCTCCTTGCTCGTTTTTGCTACAAATTCCTCAGCTTGT
TCCCGCAGCGATGCCCGTTCATTCTCCAACTGTAGTTTCATCTGCTCTTCGACATTTGCTACATAGTCCTTTGCTTCTTGCAATATACTTGAATGCACAC
GACCAAACTCTGCGATCCTTTTTAGTTGTTCATCTGTCAGAAAGTACAAAATGAACACAAATGAGTCTTAATGACAACCTAAAATAACGCCAAATACCCT
TTAAAACATACTCGAGAAATGGTCTTCGACATGGAAAATCACTCGTTGCTGCCACCTCTCCAGTTCTGACACTGCGATCGTCACCACCTCCTCTTCTggt
tcctcctcctgttcaCTTTCACTAGAAGCTGAATCCTCTTGTCGCCTCACCGTCACATCATCCCCGCTATTTTGCCGTTTCCGTCGATTCTTTAGTCGTC
TGCGAGCATCTACTTCAGTGGATGCAATTGGTAATTTAGTCCGCAGACTTTGGACCCCAAGATGTGGCTGTGGGAAGCTGCTCGGCCCCGATTGTATAGA
CGACGGAGAGGATTCGGACGCGCTGTCCGGTAAACTCGGGTTCACGTAGCGTCGACCGACGCGCTTGCGTGTAAGTGGAGCCTTCGTCTTGCCCATCTAG
GTGGTTGTCGAGCCAATTGGTGTCAGTTCGAGTTGGTGAATGGCTCAGATGCAGCTTTTTGATCAATCAGAATAGGAAAAGATgatgattggtcaaaata
ggaagcaagttgaagttgggTTAAGGGCATTTTTCAACTGCCGCTTAGACACAATTGATCAacgaagttgctggaggatACGAGCTGCAATTGATACCAA
GAAATAATAAATACGAGTGAGATATCATACAACTAGAAGATAAAATGCTTGGCAATTTAGCACCTGCAAGAACGGCTGCACCAAAACCGTTATCGATGTt
gacgacaccgacaccaGGCGAGCAAGCGTTAAGCATGGTCAACAACGGGGCTAAGCcactgaaggctgcaccaTAGCCAACGCTTGTCGGAACTGCGATC
ACTGGCACATCCGTGAGACCTCCCTACATAAACAGTATGCAAATGGCCGATGAGTGCATCGAAGCGATGGCGAAGTCGGCATAACACTTACCACCACTCC
TGGTAGAGCGCCATCCATGCCAGCTACGCATATAGCTACGTCCGATGCGTGCAGAACATGTTGGTTGCGTAGCAAGCGATGGATCCCAGCCACACCCACG
TCATAAAGACGAGTAACTTGATAGTCTGCTAACTCTGTTGGCGAGGCAAACAAAAGTAATAAATGAGTTTTCAACGTGAGCAATGCAGTTTCACACCACT
AGAAATGTTTCACCCAGAGtaacagcagcttcttcagcgactGGAAGGTCCGAAGTTCCTGCACAGAGGACACACGCCGTGGGGGCCTTCTGCAAACATC
GATCGGAATGAATAGATAATGCCTTGTAAGTGAGCCAGCAGAACAATGTTTCTAAAGGAAAGGAATGGAGCTACCGCATCACCTTTTCCGTCTTAAATTC
GTTTGTCTTGCTTGCCGCTGCATCACCAAGCGCTTTCGAAGCCAAGATCCGAGGCACCTCGTAGTACGTTAGCTGCTGGCCCTATCGTGCATACAAACCA
CACCCAGAACTCAGTTCACAGCTACCCCAATTGTATCCCCCACTGTTTCACAGTTTCCTCACCGGCATCAACGTGCGGatttcatctgcagcttcttttg
TGACGCGTGAGGCCATGACGTTGTCCTCTCCTCCGTCAATCATGACTTTCATGATGGTCGCCACTTGCTCCGACGTCTTGCTCTCGGCATACACCACTTC
CGGGAAACCTGTGCGCACCCCCCGTTtggtgtcgatcttggcgtAGTCTCCCACCGCCTCATACTCAAATTTGGAGCTGTAGATCTCCGCCGCCTCAATT
GGAGAGACTTTCCC