Description :
From Genome Similarity Track
Location :
Scaffold_207:21682- 26072
Sequence
4390 bases(100 bases per row)
ATATGACTGCTGCCATGTCGATGACGCTAACAGAACAGCAGAGAGGTTCATCGACCATCTTGGCGTCATCGGTGGTGTTGATACAGCCTGAAATACAGCA
ACAGACTCTACAGCGCGGTGATTGCGATGTTTAAGACGTCGAGCTTGTCAAACCGTGCAAGTCGGAAACGAAGGGCGCAAAATATGGCGTGATGGTACAT
ATGGATAGCTTGGGCGTTTGTGTAGCATGGTGTGTGGGCAAGGGAGCCGTTGAAGCAGTGACGAGCCGAGGAATCGATTTTTTGTGGTGAAGTAGTCGTC
AGCTCGCCAGTTTGCCCGAGTGGTCGAAGGGGTTACGTTCAGGTCGTAATGTTTTCGAACGCGTGGGTTCAAATCCCACAGCTGACAAGGCCTTGTGCAT
ACACGCACAGCAAGGCTTCATTAATCCATTTGCACGCATCAGGTGTATATGTAGCCGTTTGACCTCGCCGGTCGTCCGATACCACGATCCTATCACAGTA
GTGAAGTTGTCCTCGAGTAAAAACGGACCGGAAAACTTGACGATTGCACCATGACACTTTAGCTGCCTTCTCCGCAGATGACGTTTGTATTTCTTGATCG
CTGGACACACCCATGACTCCTACGCTTCGACTATCAAGCAAGCGGACGTCAAACAGCGTGTGCTTTATGGATGTAAAGGCAGAAGCCAATCTGGATAGAT
CGTATAAGATACGAATATGACTGCTGCCATATCGATGACGCTAACAGAACAGCAGAGAGGTTCATCGACCATCTTGGCGTCATCGGTGGTGTTGATACAG
CCTGAAATACAGCAACAGACTCTACAGCGCGGTGATTGCGATGTTTAAGACGTCGAGCTTGTCAAACCGTGCAAGTCGGAAACGAAGGGCGCAAAATATG
GCGTGATGGTACATATGGATAGCTTGGGCGTTTGTGTAGCATGGTGTGTGGGTAAGGGAGCCGTTGAAGCAGTGACGAGCCGAGGAATCGATTTTTTGTG
GTGAAGTAGTCGTCAGCTCGCCAGTTTGCCCGAGTGGTCGAAGGGGTTACGTTCAGGTCGTAATGTTTTCGAACGCGTGGGTTCAAATCCCACAGCTGAC
AAGGCCTTGTGCATACACGCACAGCAAGGCTTCATTAATCCATTTGCACGCATCAGGTGTATATGTAGCCGTTTGACCTCGCCGGTCGTCCGATACCACG
ATCCTATCACAGTAGTGAAGTTGTCCTCGAGTAAAAACGGACCGGAAAACTTGACGATTGCACCATGACACTTTAGCTGCCTTCTCCGCAGATGACGTTT
GTATTTCTTGATCGCTGGACACACCCATGACTCCTACGCTTCGACTATCAAGCAAGCGGACGTCAAACAGCGTGTGCTTTATGGATGTAAAGGCAGAAGC
CAATCTGGATAGATCGTATAAGATACGAATATGACTACTGCCATGTCGATGACGCTAACAGAACAGCAGAGAGGTTCATCGACCATCTTGGCGTCATCGG
TGGTGTTGATACAGCCTGAAATACAGCAACAGACTCTACAGCGCGGTGATTGCGATGTTTAAGACGTCGAGCTTGTCAAACCGTGCAAGTCGGAAACGAA
GGGCGCAAAATATGGCGTGATGGTACATATGGATAGCTTGGGCGTTTGTGTAGCATGGTGTGTGGGTAAGGGAGCCGTTGAAGCAGTGACGAGCCGAGGA
ATCGATTTTTTGTGACGTGTGGTGAAGTAGTTGTCAGCTCGCCAGTTTGCCCGAGTGGTCGAAGGGGTTACGTTCAGGTCGTAATGTTTTCGAACGCGTG
GGTTCAAATCCCACAGCTGACAAGGCCTTGTGCATACACGCACAGCAAGGCTTCATTAATCCATTTGCACGCATCAGATGTATATGTAGCCGTTTGACCT
CGCCGGTCGTCCGATACCACGATCCTATCACAGTAGTGAAGTTGTCCTCGAGTAAAAACGGACCGGAAAACTTGACGATTGCACATGACACTTTAGCTGC
CTTCTCCGCAGATGACGTTTGTATTTCTTGATCGCTGGACACACCCATGACTCCTACGCTTCGACTATCAAGCAAGCGGACGTCAAACAGCGTGTGCTTT
ATGGATGTAAAGGCAGAAGCCAATCTGGATAGATCGTATAAGATACGAATATGACTACTGCCATGTCGATGACGCTAACAGAACAGCAGAGAGGTTCATC
GACCATCTTGGCGTCATCGGTGGTGTTGATACAGCCTGAAATACAGCAACAGACTCTACAGCGCGGTGATTGCGATGTTTAAGACGTCGAGCTTGTCAAA
CCGTGCAAGTCGGAAACGAAGGGCGCAAAATATGGCGTGATGGTACATATGGATAGCTTGGGCGTTTGTGTAGCATGGTGTGTGGGTAAGGGAGCCGTTG
AAGCAGTGACGAGCCGAGGAATCGATTTTTTGTGACGTGTGGTGAAGTAGTCGTCAGCTCGCCAGTTTGCCCGAGTGGTCGAAGGGGTTACGTTCAGGTC
GTAATGTTTTCGAACGCGTGGGTTCAAATCCCACAGCTGACAAGGCCTTGTGCATACACGCACAGCAAGGCTTCATTAATCCATTTGCACGCATCAGGTG
TATATGTAGCTGTTTGACCTCGCCGGTCGTCCGATACCACGATCCTATCACAGTAGTGAAGTTGTCCTCGAGTAAAAACGGACCGGAAAACTTGACGATT
GCACCATGACACTTTAGCTGCCTTCTCCGCAGATGACGTTTGTATTTCTTGATCGCTGGACACACCCATGACTCCTACGCTTCGACTATCAAGCAAGCGG
ACGTCAAACAGCGTGTGCTTTATGGATGTAAAGGCAGAAGCCAATCTGGATAGATCGTATAAGATACGAATATGACTACTGCCATGTCGATGACGCTAAC
AGAACAGCAGAGAGGTTCATCGACCATCTTGGCGTCATCGGTGGTGTTGATACAGCCTGAAATACAGCAACAGACTCTACAGCGCGGTGATTGCGATGTT
TAAGACGTCGAGCTTGTCAAACCGTGCAAGTCGGAAACGAAGGGCGCAAAATATGGCGTGATGGTACATATGGATAGCTTGGGCGTTTGTGTAGCATGGT
GTGTGGGTAAGGGAGCCGTTGAAGCAGTGACGAGCCGAGGAATCGATTTTTTGTGACGTGTGGTGAAGTAGTCGTCAGCTCGCCAGTTTGCCCGAGTGGT
CGAAGGGGTTACGTTCAGGTCGTAATGTTTTCGAACGCGTGGGTTCAAATCCCACAGCTGACAAGGCCTTGTGCATACACGCACAGCAAGGCTTCATTAA
TCCATTTGCACTCATCAGGTGTATATGTATCCGTTTGACCTCGCCGGTCGTCCGATACCACGATCCTATCACAGTAGTGAAGTTGTCCTCGAGTAAAAAC
GGACCGGAAAACTTGACGATTGCACCATGACACTTTAGCTGCCTTCTCCGCAGATGACGTTTGTATTTCTTGATCGCTGGACACACCCATGACTCCTACG
CTTCGACTATCAAGCAAGCGGACGTCAAACAGCGTGTGCTTTATGGATGTAAAGGCAGAAGCCAATCTGGATAGATCGTATAAGATACGAATATGACTAC
TGCCATGTCGATGACGCTAACAGAACAGCAGAGAGGTTCATCGACCATCTTGGCGTCATCGGTGGTGTTGATACAGCCTGAAATACAGCAACAGACTCTA
CAGCGCGGTGATTGCGATGTTTAAGACGTCGAGCTTGTCAAACCGTGCAAGTCGGAAACGAAGGGCGCAAAATATGGCGTGATGGTACATATGGATAGCT
TGGGCGTTTGTGTAGCATGGTGTGTGGGTAAGGGAGCCGTTGAAGCAGTGACGAGCCGAGGAATCGATTTTTTGTGACGTGTGGTGAAGTAGTCGTCAGC
TCGCCAGTTTGCCCGAGTGTTCGAAGGGGTTACGTTCAGGTCGTAATGTTTTCGAACGCGTGGGTTCAAATCCCACAGCTGACAAGGCCTTGTGCATACA
CGCACAGCAAGGCTTCATTAATCCATTTGCACGCATCAGGTGTATATGTAGCCGTTTGACCTCGCCGGTCGTCCGATACCACGATCCTATCACAGTAGTG
AAGTTGTCCTCGAGTAAAAACGGACCGGAAAACTTGACGATTGCACCATGACACTTTAGCTGCCTTCTCCGCAGATGACGTTTGTATTTCTTGATCGCTG
GACACACCCATGACTCCTACGCTTCGACTATCAAGCAAGCGGACGTCAAACAGCGTGTGCTTTATGGATGTAAAGGCAGAAGCCAATCTGGATAGATCGT
ATAAGATACGAATATGACTACTGCCATGTCGATGACGCTAACAGAACAGCAGAGAGGTTCATCGACCATCTTGGCGTCATCGGTGGTGTT