Description :
From Genome Similarity Track
Location :
Scaffold_13:216805- 225344
Transcript NameFunction/comments
g18349.t1RAW30328.1 hypothetical protein PC110_g13301 [Phytophthora cactorum
g18350.t1ETL99685.1 hypothetical protein L917_03499 [Phytophthora parasitica

Sequence
8539 bases(100 bases per row)
CGACCATCATGGAGCAGGCCCTGCAGCTGCCGCGGCTCCACCTGGACACATTCGTGGCGCAGCCCAAGTTCCTGGCGCCCATCGCGCCGCCCACGGTGCC
GTTCCCCCCGCCGACGTGGTGCGCAACTTCCTCCTTCTCTCTCCCCCGCAAATTTGGTCCGCTAACTCGTTTTGCACTTGCTTCATAGGTGTCTGCACAA
ACCCCCACGCGCAATTTCGCTGCTGGACGTGTACAAGGAGCACGTGCTAATTGCAACGGTGCGTTTTGCAGTGCAAATTTGCGCAAATGCTTTGCTAATG
CGAGTGTATTGTTTTGCGCAGCATACTGTGGACCAGAAGGCCTTCTACCTCGTTGGTAGGAACGCCGCTGTGTGTGACATCGTGCTAAGCCACTGCTCCA
TCTCAAGGCTTCATGCAACGATCGTGCACCACGAGAAGGGCGCTACGTACTTGGTGGACCTGGGATCGGCCCACGGGACTTTCGTGGACGGGTTGCGGCT
AACTGCTTTGCAGCCGACGCTCGTGGTGCACGGCGCCGTGCTGACCTTCGGGGTTTCGTCGCGCTCGTACACGTTCAAAGTACGTGTTTGCAGTTTTGGC
AGCGCAAATTTCTTTGTCTAAAGTGTTGTGTTTGCACTGTTTTGCAGTCGTTCGATTCGCGCGAACAAATTGCGCAGATTTTGCGCAACCGAGTGAACCT
CCCGCGCGAAGAGCTGCAATTGCAGCAGAATACCATGCTCAACTCGCAAATTTCGCACCGATTGGAGCTGTCGCCCACGCGTCGCAGTATGCCGCCAATG
TTCCCCATGGCCCCAGTTTCGCAGGCTCCGGAGCTGCAACTGGAGCCTCAGGTGCCTTCAGACCAGGACGCGCTCATGTTGGAGTGCGACCGAAGAGGAA
GCGGCGACGGCCTCCAGTTGCTGGGATTGGCGGGTTTTGGGCCAGTCAGGAAGCGGTCGCGCGGCCAATCAGGGAACTCGCAGGCGTCCGGATCATCCGA
CCAAAGCGGCAGCACAGCGGATCTTAGCGTTTATCTGGATGATCCGACGGACGAACAGCAGGGCGAGCCGAAAAGGGTGCACTTTTGCGGCCAGCCGCCG
GAGATTATCCCGGATGCTTGCAACGAGGATTCGATCGAGATCGAGACGGATGCGGGTCGAGTCCGTGAGGAGCTCCGACGTACAGAACTCGCCAATTCAG
ATTGAAGTTCTCGTCTCCAGACTGTCAGGGAAAATCGAGACCAAGTGCAAAACTCAGCGCTGAAGACAGAAATTTGCGGATGATTTTGCAGATTCGTGAC
AACTTTTCGCGTTCGGTCAAGAAGCAGGAAATAGTGAGGCCCCAGATCACCGGCTGGAAGTGATGGGGCTTTTTCCAGACGCAAACCAGGCCCAGAAGAC
TTTGTGGCTCGACCGAACGGTGGCGAGTAGACTTCCGGCTTCGTGCGGGTGGGAAGTTGGATGTTTTGGTCGGCGGGTATGTTGTAGAGAGTACTTCATA
ATTTAACTAGGATACGTAGCTCACGCCACTGCGGCAAGCACGGATAAGCGAGTGCAAATGAAGCGATGTAAGTTTTGGACGAGTTGTGCAGTGAAAGAGC
TGACGTCGAGTTGATGTTGAGGCCGGAAAGCGAGTTGAACGTTGGCGACTTGGAGGACAACAAGACGAGCAGGACGTCCGAACGACGGCACATCGGAACT
TCTCTTCCTCTCTACTCTGGAGCGACGATGGACTTCCGTACGAGAAGCAAAAGGGTATGAAAAACTTTCGTATTATCAATATGTAAAGAGCAAGATGCTG
CAGGTAAAACAAGACGCGCCTGCCTGTGGTGGGCGCACTACTACTCGGATAGAGTACAATCCGTCACCTCGCCAAGCCTCTGCGCGGCACCGTCTACGGC
GCGCTGCCAGCAGGCGACTCGTACATCTGATAGTTCGAGTGCGACTTGGCACGCGAGCGGCTGAAGTTCCTTGAGCGCGCGCTGCCTGGTGTGCGCGCGC
TGCGCCGAGACGCCCGGATGCGGCGCAGACGTGCGCGCTCGGCCTCCATCTCGCCCTTGGTGCACACCATGCCGTTCTTGAGGGTGCCCACCGTGAACAA
CAGACCCGTCGCCACCACGCAGCAGCCAGCCAGCGCGAACAGGTACAAGTACTCGTTGCCGCTCATCGACTCGTTGGAACGGATGTAGGTGGCGCACACA
GGCAACAGGAAGAACACCATGAAGTAGACGGTCACGTACACCGCGCGCTGCTTAGTGGTGAACAGACCGACGCACGACACCCAGGGGACAGACGTGAGCC
CCAGACCCGCGAAGAAGTACAGGAGCAGGCCCACGATCTGCAACATCAAGTACTCGTTGTCGCCCGTCACAAACTCCGACTTGGCGTTCAGGCCCAGGAC
GAACACCAGCGCGGCGATCGGCAGCAGCGTGCAGAACATGATGCGCTTGTGGTCAATGCGGTCCATGAAGAAGAACGAGAAGAGCGCACCCAGGAACTGA
AGCGCCATGCAGTTCACGAACATGTACGTCGCGTCTTCAATGCTGCGGAACGCGTCCGACAGGTACATGTTGACGCAGCCCAGGAAGATACTGGAGACCA
GCATCAGGAACAGGCCCATCATGAACTTGAGGAACGAGGTTCCGCTGTTGGCACTCGCGTCGTCGCTGCCGGCCTCTTCGTCGCGGATCATGCGCAGCTC
CTCAGACACCCCCTCCTTACGACGCAGCACGGCCAGGCAGCGCTCGCAAGACTCCATGCCCTCGCGCATGTACACCCAGTACGGGCTTTCCGGGAAGATG
TACACCGCCGGGGTCATGATCGACAGAATAATGGTCGCAATGAACACCTGCCACACCCAGCCCACCTCGTTCGAAGACGAAGAGAACCAAGCCGCGAACA
AGATGCCAAGAATGAAGCCACTGCCCAGAAGCAGCAGAGCCTTGCCACGCATGTCGCGAGTGGAGATCTCGTAGATGTACACAGCCAAAGTAGGCAGCAG
CACGCCCACAGAGCCGCCGAGCAAGCAAATGCCAGGCATCAGGAAGCCTTCGCCACCCGACTGCACCGCGCTCACGCCAAGCATGCCGACCACAGTAAGC
AGCCCGCCGAAGACGATTGACAGGCGACGGCCAATGAAGTAGTTGATGAAGCCAGCCACGAACACGCCAACCATGCAGGCAAAGTAGAACGCGTACGTGA
CCGAGCCGTCACCGACGTTGCCGTCCAGCAGATCGTAGGTCGTTACGTAACTCAAGAAACCAGCCGTGCTCTCCAGTGTCGTGAAGAGGTGGAACAGCCA
GCCGCAGCCCATGCCGCCAAGCACGCCCATGAAGGCCGCCAGCGAGAACGCGTACTGCGACGACGCAGACACGACCTCCGAGAAGCCCTTGTTGTACATC
ATACGCGTCTGGATGATGTTCAGGAACGGGATGGCCGACATGACGAGAAGCGGAATGATCATAGTCACCGAGAAGATGAAGTCGAAGAAGAACGCCAACT
GCTGGAACATGCCCACGGTAGCGATCGACGAGTTGGCGAAACTGTACATACGCGCCATCTCGTTGATGCCGTACAGGGCCGCCAGGTAGCCGAAGAACAG
TGAGATCGTCCTGGTGAAGCTGACGTCGAAGATAGCAATCGTGAGGACGAAGAACACGATGAGCGCGAGCACCACCACGAACAGATACGTGATCGCACGA
ATCGACGTGTTCACGCCGCGGAAGCAGCTGCCAGCAGCGCCAAAGAGACCCATGGCCAAGACGGTGATCACGGACGCAGCAAACACCAAGCCCACCGAGA
TGAGCTCCCACTCGAGTGCCACCACGTACCACATGAGCAGGAAGTGACGGCATTCACGCAGAATGACTGTGAATCGAGCAATCGGCCTCGTGTTGTGGTA
CAGCTTGAGCTCCCCCTTCCACCAGCCGATCCAACCGCCGACCATGACAGAGTCCACGTCCTGGTAGTCCTCGGGGGCGTACATCCACTTGGCCCACGCA
GTCACATCAGCCTTGGTCTTCTCCCAGTCGAGTCCGTCCGTGTTGAAAATGTACGGGGACACTAGCCACACCACCGCGATAACCCAAATGGCAAACGTCT
GCACGCCGAAGCTCTGCGACGTCTCACAGTAGTCGAAGGCGAACGAGTTCGTTTCGCCAGCGACAGACGTGTCACAAATGTCGAACTTGCCGAACGCCAA
GTAGACCAAGCACAAGCCAACGAGCTCCATAGCCTTGCGGTAGTGACTCGGGGCGTACGCCTTGTACAGCAGCACAAAGGTCTCACGCGTAATCTTGAAC
CCACGGCCCGTAGCCTTGTACTGAGCCTCACCGTGGAGCAAGTTGTTGTCAAAGAAGTGCATAGTCGTACCCAGCTGGAAGATGAAGAACGCCGGACCAG
CGGTGAACACCATCTCCAAAAACTGCACCAGTCCGCGGCGCAGACCCATTTCAGCGAAGTACACACAAATCAGCGGCAGCGACAGGAACAGACCGGCCTG
GATGTAGTACTGCGTGTTGTACACCGAGTCCATGTCGCTGTACACACGGTCGTCGAAGCCGTAGTTGTACGAGTTGGCCATGATCACTTCCGTAGTGTTC
ATGTTGTACACAATCTGCGTCTGCACGCCCGAAAGAGCGATGTAGACCTTGCAGTACATGTACACGAACGTCGTGACAATCGTCATCCACGTCGCGTAGT
AGAAACCCGTGTGCGAGTAGTACATCGAGTTGAGGCGGAAGAAGTCCATGAACTGGCCCATGCGGTGGGCCTCACGCGCAAGCGAAGTTTCGCCGGCACC
GTTGGCCAGCTTACCCTCGAACATGGAAATCTGGGAGAGAGCCACATCGCGCCCCTTGCCACACTGCATGAACTCCACGTGGGTCACGACTCCGCCACGC
AGCGTCGTGTTGAACCCAGCGAACACATCTTCCGACAGGTTGATACCCTTACTGGACTTGGACACTCCACCGCGCGTAATAGCCAACACCTTGTCGAAAA
CATCCGGGTGGCCGTAGTGCATACGCACGTACAGAGGGTCAGCCAGCACACGCTGCGATAGCGTCACGAACACCAGCTCCTGCCACGTCTTGAACTTGGC
AAGCGAACTGGCGTTACCCGTGAAAATGTGCTCACGCATGCCAATGATCGACACCGGCTTCTTGGACGGGTGCAGGTCCGCGGTACACAGAAGCTGCGGC
ATTTTCAGACACTCCTCGAAGTAGTGCTGCTGGTTCATATCAATCGTCTGCACGAACTCGCCGCGCGTGAACGGGACAGCGTTGTTCTGGTTCTCCGGCT
TACCCTCGCCCAAGATCGGATCACCAGGCAGCGAGTAGCGGTACACTTCCACGATCTCATCGGACTCACTCTTGATCAGCACCGTATCGAACGACTTCTC
GCCGTCCTCGTGGTCCACAGTGTCCACGTAGGCCACACGCAGGTTCGGGTACTCGCGCAGCAGGTAGTCGATATCGGCAGCCTGCGTCTTCCCTTCCATG
CGGTGCTTACCGTACACCTGACACGCACAAATGTACGAGAATTTCAGACGCACCATATCCTGCAGCTGGTTCTGCTTCTGCTCCGCCGACTTGCCAGGGC
TCGAGCCGATCTCCAGCCAGTGCAGAATCTTAATCGCATCCTCGTACATCATCATGCCCTGCACCGTACGCGCCAGAGTCTGGCCACGGTACGACGCCCA
CAGACGGATCTCCTCGGGGTGGTTCTTCTGAGCCTCCTCGGCGGAGCTCACGTCAACTCGCTCCAAGAAGTTGTCCCATTCTTCCTGGTGGATCTTCGTC
AGGTACTTCAGAATCGTCAGGTTCTTGCCGTCCTCCTCCACCTTCTGGAAGATCGGGTGGTTCACAAGCGGGTCGTTCAGGTCCTTGAGCGAGAACAGCA
CCGTTTCGGCGTAGAACGGAGTCACGACCGAGAAACTGCGCATCTCCTTGATGGAACGCAGCTGGGGGATGTCCATCACCAGCGACTTCATGAAGAAACC
AAGACGACGCTGAGCCTCCGTCGTGCGTGGCATGGCCTCCGAGCGGTCCAGCGACAGCAGCAGGCAAGCACGCGTAGCAGCGCCCATAGCCGTGTCACTG
CAGAACAGGTTCACGAGTCCGCGCGAGGCATACATGTACCCGTTGGCACTCGAGCAGAACTTCGAGTTGGCGAACTTGCGCTGCAGAGCAGGGTCCACAC
AGAACGACTGCACACCGTTCAGGAACGCTTCCATCTTGGCCACGAAGTTGCGAATCACACCCATCGAGTGCACGCGCGCGTTCGGGATGTGCTGCGACTG
CACGTCCGGGTCCGGCAGGTCCAAAATCTCCTCAAGGAGGTCCACCGCAGCCACGCGCAGACTCGCGAGCTCCCGCACGTTGAAGGACTTGAGGAACCCT
CCAGCAGCGGCAACTTCCTCGAGCTGGCGGAAGCCGTCAATCACATCAGCGTCGTCGTTGCCGAACAGGGCGCTAATGACGTACATGCTGGCCGTAAAGA
ACGAGCGGATGGCCGAGAGGCAGTCGTTCTCCACGAGCGTCACGCGCAGCTGGGACTCGCCCTTGCCGTCCTTGGCCATCTTGATCGCTAGTCCCATCGC
CTCCGTCAGCTTGCCCGCCGACAGGAAAACAGGCTCAAACACCTCGCCAGTGCTGCGGATGTCGTACTGCAGAATCGCAGCCTCCTTGTCGTCCAGAAGG
TCGCCCTCGCGGAACGAGTTGACGATCTCATTCCACACCACCACGAAGCGCAGCATCATCTGCGACTCGTACGCAGCCGCCAGGGCGCTCGCTCGGGTCG
AGTCCGAGCCGCTAGCAGTCGCGTCGCTCGAGCGGGCGAGCAACGTCACGACCTTCTGGTCGAACAGCTGCGGCGCGACGCGGAACGCCTTGGTCATCTC
CTTGGCGCCTCGGATCTCGCCAGTCTTCATCAGAATGCCCTGGAAGCCTCCAAGCAGCGCCTGGAAGATCGTAAAGTAAATCTGCGTGGCGTAGTTGAAA
ATGAACACCACGGGCAGCCACAAGGCGATAATAATGCCGATATTGTGGAACGACACCAGCGAGTTCTGGTAGTCCAGCGTCATGTCGTAGATGCTCAGCG
TCGGTAAGATCAACGGCCGGACCAGAATAAAGTACGACGTGATCGCCTCCACGATCCACAGGATGATCCAGAAGATAATATACTTGATCTGGTACGAGAA
CGGGGGCGTCATGTCCTGTCCGACATAGCAGCTCTCTCCTTCGCGGACGAATTTCGCCGCAAAAGTGCCGCTAATCAACTGAGGTGCAAAGGCCTGCGTC
AGCAGCACCAGCAACCCGGGAAGAATGTAGGCGCCGCACAACGGGTACAAATTATCCAGCAACGTCGTGTCCTTATCCTGGTTCAGCGGCACATAAATCA
TGACCCCAAAAAGCACCGCGAAGCCGCCGTTCCAGATGATCCGCGTGGCCAGCGCCGACCCGTACGAGAACGAGCGCGAGCTCGACGCCGATGACTCCTT
GGACGTCAGCAGGTGCCACCCGTGACACACCTCCATCACACACTTGAGAAAGGCCATGAGACTCAAGCTGAAGGGGATGGCCACGACTGCGACCTTCAAG
TCTCTGGTTGAGTAGGGCTCCACGACGTCTCCAATGCGGCCGAACTGGACCCAGCCGCTCTTGCCGCCATCGGGCGAGATGGTGACGGCGAAGGCCAGCA
CCGTCAGCAGCACCATGAACATCATGTTGAACTGGAAGATGCGGTAGTAATTCAGCACCATGGTGAACAGGCTTCGGTGTTCGTAGAACGTCTTGCCGTG
GTTCTGCGTCAGCTCCTGGCCCACCTGCGCCACGGGGATGCTGAGGCAGTGCTGCTTCCAGAAGTACTCGTTGATGTCGTCGTAGTTGCGGATCTTGACG
TGCTCCAGGGGTTTCCCCAGCGCGTTGCGGCGCTTCATGTTGCTGGCCTCGCGCCAGATGGGGCGCACGACCTGCGCCAGGTACCAGCCTTCCGGTTGCC
GCTCGCGGCCCTGCGGGTCGGCGTTCACCATGGTCAGCATCTGGTGGAAGAGGTAGCACACGCACTCGGGCATGTGTCGCACGTTGGCGGCCTCGCCCCA
TATCAGAAAGTAGAGCATCACGTCCATGTGTAACTTGTCGCTGCCCGAAGCCTGCGGGATGCCGTCCCCAGTGTACGTGGCCGGCTGCGTGTGGATAAAC
TTGCACCACGCCCGGTAGTTGCTGAAGAGCTTATTGGCCAAGCGCACGAGGTGCTCGTCGGGCGCGTCACTGGGCAGACACCGCGCCTTGCCGTTGGCCA
GCAGCAGCAGCACGTGCTCGCGCTGATTGCTCACAGAGCCCTCCTGGAACCCGAACTTGGCCTTGAGGAACTCGCAGCAGTAGTCGATGGCCGCCTCGTC
GTCGCCCTTGGCGCTCGTCACGTCCATCGTGTTGAGCCGCGAGCTGAAGCGCTCCTTGCGCTCCGACTTGTTGCGGCGCCGGTCCGCGTCCAGCTCGAAG
TAGTTGGAGCTCGCGCGCCGGCGGCGGTCCATCTCGCCG