Description :
From Genome Similarity Track
Location :
scaffold_6:2168- 39137
Transcript NameFunction/comments
Pl_112741prolyl-tRNA synthetase, putative
Pl_112742conserved hypothetical protein
Pl_112743conserved hypothetical protein
Pl_112744hypothetical protein PHYSODRAFT_293759
Pl_112745hypothetical protein PHYSODRAFT_476353
Pl_112746hypothetical protein PHYSODRAFT_321832
Pl_112747hypothetical protein PHYSODRAFT_469112
Pl_112748Intraflagellar Transport Protein 140
Pl_112749conserved hypothetical protein
Pl_112750hypothetical protein PHYSODRAFT_469049
Pl_112751HSF-type DNA-binding protein, putative
Pl_112752hypothetical protein PHYSODRAFT_309064
Pl_112753hypothetical protein PHYSODRAFT_468056
Pl_112754hypothetical protein PHYSODRAFT_554409
Pl_112755hypothetical protein PHYSODRAFT_321823
Pl_112756hypothetical protein PHYSODRAFT_343735
Pl_112757U4/U6 small nuclear ribonucleoprotein Prp31
Pl_112758hypothetical protein PHYSODRAFT_475074

Sequence
36969 bases(100 bases per row)
TCGCGGTCTGATTTCATCACGGAACTTGCGGCCGATCTGGTACAGCCTCAAGGACGAATCTGCAACCCCCACAGCACTGTAGTGAGCTGCCACGAGGCTC
GTGATGCTCTCTTCATGTGTGGGGCCCAGCACCAACAGATCTTCGCGTCGATCCTCGAGTGTCATGAGTTCCGGACCGCGACTCTGCCAGCGACCTGATT
GCTTCCACAGCTCGTTGGGCGTCAGCACCGTCAGATCCACGCGATTACCACCGATCTTGTGCATCTCCTCGTCGATCAAAGCCTCCAGTTTGGCGACTAC
GCGGCGACCAAGCGGCATAAGTGCGAAAAGTCCGTGACCACCTTTGCGCACGAAACCAGCGCGTATCAAGAGCTGGTGACTGGGAACTGCTGCGTCTGAA
GGCGCCTGCTTCTCAGTGGGAGCCCACAGTACGGACCGCAAGGCGCATGGGGCAGCACGAACTGCTTGGGATGTCGAGAAACGCCGCCCTGCAGCCGCTA
AGGAGCTGCGACGCGTGCGAACCGCCCACATTTTGACCAGCAAGTGTCTGAGGACTAAAAAGGCAAGTATCTATGTGGTGTGGGGCACACTTTTTTACGT
GAAATACATAGGTTCAAGTATTACTTGATTTGATCATGAGATATTTGTTTCTCAAAGTGGAAGCAAGGATTTGCTCAAGTGCTTGAAAGGATGCAGTCGA
GAACCTAAAACCTCATGAACAGGACAAGCTCCCTATGCAAACAGCAGAACACAGGTTCTCTCTTCAACGATCAAAAATTGTAGTTCAACGGAGAGGGCGG
TTTGAGATGCAAGTTTCATTCGCCAGCTCATTTCCCGTGAAAGCACTGGTCAATACGGAATGTCCAAGCTGGATGCTTCCTATTTTAAAGTTGCACTGCT
GAATTCCATAGTACTCGTTGGCGCTATGTCAGTGCCAACGCCAGCTGGTTGTTGATGTGGTGGACCAAGCTCCTCAATAATTGAACATTGCAGTTTCCTC
TACACAACGTTTAGTCCGCCTTTGCCTTGAGCGTCGCCCACTCGTGGCCCGCATCGTAGTAACGTCCTAGTAGCGTAGCGTCGAGTTTGACCATGGCGTC
GACACACGATAGCATGCAAGCGATCGACGGGTTCTTCGTAGTGCCACAAAGCTACACATATCATTTGATCCTATAAAACACGCACGCATGCTTAGGAGTC
CATCGAACACAGCCACAGTCCAACGTAGGAAAAGTGTAGATGAAGCTGGATTTTCTGCCAACTCATGGTCCGTAATATATAGTGCACTATTCCATTACAA
TTTTCCAACAACTCTTACTCTGTCCCGTTATAACATGGGCAGGCGCATCAATGTGAAGTTGCACGAAACAGCTGATAAAAAATAGCAGAAGTAGGTGACG
AGTCGCAATTTTCCATTCCGCCTCCTGATGGCTTCGGGTTGGCGCAAGAACAAGAAATCGCTGGACCCGTGGGGCCCTCCATCGCCTCCGCCACTGCTGG
ACGAGGCCGCGCCGAAGCCCAGCAGACGCTCGCACTTCTCGCGTCGCAGCACACGCGCCAAGAGCCAAACGCGGCTGCAGGCGCAGCATCTGGAACTGGA
AGTCGAAGAAGTAGTAGAACAACACGACCGCGATAGGCGCCGCAGCCTTTTATTGTCCATGTTTGGAGATCGCACACTGTCACGCACGTCGCGCTCGTCA
TCGGACACCACAGAGGCGCCGCAGACACTCGTACAGCGAGAAAAAGGCTTCCGATTGGTGCGACATGGCTCCGATCCGCTCTTGAATGACTCCTTCTATG
CCACACAAGTGCAGGTGGGCAACTTTGTCAAAATGGGATGGCTCACGAAGCAAGGACACATGTGGAAGAGCTGGAAAACGCGCTTCTTTGTCTTGTTTTC
CGATGGAACTTTTGCTTATTATAAAAACAAGGGACGGAAGAAGATCAAAGGATGCATGCAACTCAATGACGGAGTTGTGTCCGTGCAGCACGTGGACATT
CGAGTTGCTGAAAAGGCCTATGTGTTCCAGATTGAAAAGGGATTCTACAAGTTGATCTGCTACTGTTGTAGTCAGTTTGAAGCCGAGCTGTGGGTTACAG
CGTTGAGGTCGGTTAGGAGGGTAGCACCACCTTGTTATGAGATGGACTTGACAGCGACAGAGGAGAAGGCAGGATCCAATGCAGTTACCAGACACTTGAA
CAAGATCTTCATTACGGATAAACAGGTGGCCAAGAATTTGGTGGAATTTAAGGAAATCGAGCACGACCACTCGTACGCATCAATTCACAATTTCATCGTG
GAATTGGACGATGCCATTATTGATCGCCACCATTTGGAACTTTATCAGGACCCTGAAATTGAGTTGTTACCGGGTAATGATCTCGTACGACTCATTCGTC
GGCATGTGGAAGACCGCGTGTTTATTCCATTGTATGCGGAGGCCTACTCGAGCTTAGAGACGGATAAGGTGAAGACAAGACGCAGTAATTTGGAGAAGAA
TTTGAAGGTGCTAAAACAGAAAACGCAAGCGGATTTCGGCGTCTCGAAAGATGTGTCAATTTGCAATTGGAAGCAAGCGATCAGTGTGATCAATATGCTT
GATTGTGTTTCGCTCCCGACACACAAGTTTGAAGTCATTTTGTCTGCTGGAAAGGCAATCACAGAGGCGATTGCTCAATATAATGGAGAGCTATTCGAGG
TGTCAGACGAAGCGCTGACGGGAATTTTTCGATATGTCGTAACAATGTCATCACTCAGGGACTTACCGATTCTTCGGGCACTACTAAAATATGGTTACCA
GCATCACCCAGCGTGCCAGAACAAAGCAAATATCGTAACAGCTTTTCTCGACGCGATCAAATGGGTAGAGTGCTTTGAAACCGGCGATGAAAGCTACCAG
TTCGACTCGACGGCACTGGCTGGGTCTCGTGTTTCGGTGTCCATCTCAACCAACGACGTTGGCATCCAATTTACTACGGATGGAAACGGGCGAGGGGCCG
TTGTATACAGTGTTCGAAAGTTATCTCAAGCAGCATTGAGCGCTGCCATCGTACCTGGCCTTTCTCTGATTGCAATTAATCACGAGCCTGTAATTGGGAT
GCCTTTCGACAAGATAATTCAGCGCGTCCGGACAGCAGCATTGCCGAAGCAGCTCACTTTCATGACGGAGTTTTACTACTATCAGTTGCTGACCCTGGAC
TCGGAAATGTTCCAATATTTGATGTGCATTGCAGCTCGTCGTGGAGACTTAGACTCGGCTGCTTGGTTGCGAGCATCAACCATGGAACTGAATACCCTCT
GTTCGTGGGAAAAGTCTCGAGGGAAGCAAATTTTCGGATTCATTCCGGTGTCTGGTAAAGGATCGCCACTCCATGCAGCTGTGCACAATGGGCAACTTGG
AATGGTCAACTATCTTATCTCGAAGGGGGTAGACACCAATTTGTGCAACCACAAAGGAAGGCGACCACTGCATATTGTGAAACAATCGATAGACATGGCA
CTGATTATTCAAAGTCTGACTGATGCAGGAGCTGATATCGATGCAGCAGAGAAACATGGCCTTACTCCTTTGATGTTCATGTGCTCCAGGGCATCTCTTG
AAGGTTCTGCTACGCTGCTGGCCCTTGGAGCAGATGTGCATCGTGTAGCTTGGTCAAATGGTTTTTCAGCTCTGGAGTTTGCAGTTCAGAGTGAGCGTAC
AGAACTCGTGGAGCTTTGTCTTTCGAAGGGAGCGAATCCAAATTCGCCCACCTTGGACGGAAACACCAGTCTGCACTTGGCTGCCGCTTTGGCTCACACT
GATATCATTCTTCGACTACTACAAGGTGGTGCAAACCCCAACAAGCAGAACCGGTATGGCCAGACTCCAGCGACTGTCTTGCTAGCTTCTGCTTCTGTCG
GAAATGGCGATGCCCGAATACTTTGCTTGGAGATTTTGACGTGTGCAGGTTGCCGTCTTGACAAACGTGATCTATTCGGTCGTCAAGCCTCTCATCTTGC
TAACATATTACGAGATTCTCGTGTGGTTGGATTACTGCGGAAGTTGGGATCTCTTAATCGAGGAGGGAACGGCATCGATGTGGATATATTTGGCTTTTCT
TCTGTTGATTATACCCATCGCATTGAGGTAAACAAGGCTGCGGGATATCTGGGCTCGCAAACGCCCAACAATTTGTGGGACATTGTAGACAAGAACGACC
AAAACCCGCGATCCTTACGTTCGAGATCTATCGAAGATTTAATTCGCGAGTTGCTATCTGGAATGGAGGCGGATTTCGTGGATGTTGTGGCTTTTGTATT
GTTCCTGGACAGCTTTTCAAGCCTGAATGAAGTGGTGGATCAACTAAGCGAACACGTTCGGAATGGGACCAAAAGTGAGTTTGTGTATCAGTGTCAAATG
CTTGTTTGGTGACTGTATGACCATGTACTGACTTTATTGTTTATGTGTTCGTTCACCTAGACCACGGACTTATCCGTCTCTTCGTCATGATATTGCTGTT
CAGGCAATCAGAGACGAGGGGAGGTGATGACCTCCATGATCGTTTCTACAGCCTCATTAGCCATAACATTGACGTATCGAAGGAACAACTGGTACCTTTG
ATTAACGAGTGTACATCTCTTCACAAAGCGTATTTCTCCCTGCGTGGAGCTGGAAACTATGCTGTAAACTATGAAACGATTCCCGAAACAATGACCAAGA
TGTATGGGTTAGACGTAGACGTCGGACCTTTCTCCAACGAATCGTTCCCAACACATTTGCATCGGTGAGTCACCATGCGAAGAGGTTTGGAGCAATTTAT
CACTGAATTTGTTTTGTTTGTGTTTTCAGGTACATTGACGCAGAACAGTGGGCTGAGCAGTGCACGCTTCTGACGCACGCGATCTTTTGCAAGATTCCAG
GTGAGATCCTTGCTATTGCCTTCATAAGGAGATAGGGAACTGACTATTGTCGTCATGATCAACTGTAGTACAAGATTTCGTTTCAATCAGCACGAAAAAA
CAACATTCTGTTGAATTTACAAGCATTAAGCGATGGTTTCAACACGTACGAACGCAAGACGGTGGGGTTATTGGTATTTACTAACAGACATTCTTACCGT
GACTTGCGTAGATCTCGGCGTATGTGGTCAACGCTGTTCTTGTCCAAAATACACCCGAAGAACGTGCAGAAATAATCTCGTTTTACCTCAAGGTAAGGCA
ATATCTGGACCACACATTGGCACACTGCGTGCTAATCCGTTATGTATTCTGATCAGGCCGCCGATTATTGTATGTCATTACACAACCATGATACGTTGGC
TTCGATTTTATATGCGTTGCAATCAACTGCGGTGCAGCGACTGCGAAAATCAATCGACTGTGTACGTTTGTGGAGGTCGTATTTCTAATTTTTTAGTTTT
TCCCTGACCTTATATTCGTATGTACGTATTGCAGCTCAGCGTCGATGCGAAGAAAAAAATGAACGAAATGCAACTGCTCTCAGACAAAGGATGTCGCGAG
ATGAATCGACTAATGCGCAAGACTGCTAACCCAAGCATGCCTTACATCGGATTGTACCTCCAGGTATGTGTATGGTAGTGAAATGACTTTGCTACGACGC
TAATGAATATCGTTATGATTGTGTTTTAGGGTTTCGTTGGGCTAAACGAGCTGCCTGCTTTTGACAAAGAGGGACTGGTGAATACAAGTCGGCTGCGAAG
GATGGGTGAATTGGCAATGGAAATCTTGCATCGCCAGTCAGTCGCGTACACTCTCCAGAACGACGAGAACGTTGATGTGAGTAGCGCTGCAACCCACCCA
CTACCATGATTTCAGGTTTTGATCCGATTCTGACTTGTACCAACTTTCTTGTAGAAACTGTTGCACGTGTCATTGCCATATTCCTCCGAAGAGAGTCGTT
ATACTCGTTCGCTGGAGCTGGAACCGCGTGAAGCAGACGCATTGCCTTTGAGCGATCGTGGTTCGTGCGTTGTAGTCGATGATGACCTCGACCTTGAGAG
TGAGGTGCGGGAGTCGATTGGCAGTGATGGGACCTTCGGGTTTCGTCAGTGGATCCGGAAGCAACAGGTAGTGCATCGGAACCGCTCGCGTTCATCACTG
ATTGCTTTGTATGAGTGGGTGTAGCCGTGGTTTAGTGTGAATCCGGCGAGTACTTTATCTATTGGTTGTGGAATTCCGCCCAACATTAATATATTGTCGT
ATTTAGTTCTCAGCGATATATTTTTCAAAGTCCTCCATCAATATCATGGCATCAAGGCCCAGCAAAGGTTCGTGCTGATCCGTATCGATCTTCTGGTCGC
CACCATTAAGGTTGCTTTGCGACGTAAACTTTTGTACAGGAGACGGCGGGACGTCCATGGTCAAGGATTCCATCTGCTCCATGATCCAATCCCCTTTTTC
TCCAAGCATGTAGTCATCCCTAAACGCATCCACGATCGTTGGTCAGTTCCATACGGCAGATACTTCCACTACAACTTTGACAATCTTGACATACATGAGC
CGATTCAGCTGGATGTCGCCCGCGGCGGGAACGGTATCGTCAGACTTCAGTTGGGCACGCTGATACAGTGGACACCAAGTAATGTTATGAAAACGATCTT
CACATGAGTAAAATTCCTATGCCAACGCTCCTTCTTCTTAGTTTCTGAAAAGAGGTCGTGTACATCTAGACGCTTTGGAGGAGTCTCTGTCTTGCTCCCT
TTGGTGCTGGTTTGCTTCCAATGATGAATCTTCGCCACGATGTCTCTGCCAACCGATTTCAATGGTCAGTGCCAATCGAGTTTTTAAACTAAAGGTGATG
CATGAGGCTACTACTCGTCTTCCTCTTCATCTGAAAAGAATCCTCGTCGAGAGGTCGATTGGTTGTCACTGTGCTTAAGCTCCTTCTTTGCGGGAGCAAC
GTAGCCATCCGTGTGCGCTGCATCAAAAAATGAAAACGCTAACCACCATGTGACCATCAAGTTGGTGGTATCCCCCGTTTACAGCGAATGTAGTGTTCTT
ACTGAACTGCGTCTTGGTCTCCTCCATCGTGACAGTCAAAAACTATGACAAAAAGACAAAGATCGGATTGTGGAGCGGTACATTCAATGTACCGGTACTA
CCGGTGTTCCAGCTCGTCAAAGCAGCACATGAACAAGCTGGGCTTGGCAAACCTGCTGGATTATTTGCGTACAATATATTACAGACCACGCACATCCAGC
ACACCGCCTTTGAATCGACCCTTGGTTGCTTGAACGCCGTAGTCGACCTTCTTGCGCTTCTGTTGATCCCTCGACTTGCCACTCGATTTCCGCTTGCCCG
TGACGATGTCCGACTCCTTCAACTGTACACCCCAAAACAACCATAGCATCAAAACTCATTAGAAACTCATCTCGAACGTCATTGCTACGTTCCATATCCT
ATGAAATTACGTACCAGTTCCTCACGACGCTGCTTCTTGGCGGCACCCTTCGTCTTCATTCCGATAAGTACTTTGTACGGCACACTACGGCTCTTAGCAG
CTTTACCGCCAAGTGCCTCGATCTTCTTGGCCTCGTGTGCCTTTTTCTCTTTACCCTTCAAGTTCGACGTAGCTGTCAACATCATCAATAACAATATCAA
TTTAATTCAACCACCTCTGACTGCATTAACTCTCAAAAACTTTACAGCATCAACGCACCAAACTCCAGGACTGAATCGAAAGTATCGTCGAACTCCTTGC
GGATCTCCTGACGCAGTGTCATCTCTGGTTCATCCTCCTTCGCTTTATTCTAGTCACAACGAATGTGTCAACTACAAGAACTGGTGAACATCAAAGCAGA
AAGCAGAATTTTAGTACGAACTTTGGTAGCACGAGGTTTGCGCTCCTTCCATGTCTCCGTCGGACACTCGAACACTTGCACTTTCTTCTTCTTGCCGCTT
GCTACAGGGAACTGGAACGCCATCGTCAAGTCTATTAGTGATGCAGAGCAATTGGCCGAATAGCGCCAATCATCAATGTTATGTGTGCCACATCGTTTCA
ATCTGTGACGCGCGCAATAAAGCCACTTCAACAAGCATCCTTAGTACATTTTGTTATCTTAACTACGCACTCGCGTCTCATACGAGCACTTGAACTTGGA
ACAGACCGCTGTTTGCTGCTGGATGCGAGTCTTGTTCATCTAGTTCGTCTTCCACATCACTGGCATCATTCTCGTCGTCGTCTCCGTACAAGCTGCTACC
GAGGTCTGAGCCGAAGCTGTCTCGGATAGATCCACTTGCAAGAGAGTCAAGTCTGTCATCACTCTTGAGCTCCTGTTCAAAGTCGTAAAAACCTCGGCTT
TTGATAACCCGGCTGCTTCGTAGAGGATTCGCACGGCGGTTATCTCCATGTCTGTCCGCAGAAGTCGGAGAGGAAGTTGTACGCGGTGCTGGCCCCTTGT
TGCTGTGGTTCTGGGGTTTGGGGCTTAAAGGGACGAAGACGCTTTCTCCAACCAGGGACTGATTCAGCACACTTTCGTCATCAGCTGTAACGGCTGGGAT
CGGCCTGTATCGTGACAAGCGCTGGAAGTGTGGTGAATCCATAACGTTTACGATCATACGTTTGTTTGGTGTGGGCGTTGAAAAGTCAGCCATGGACATC
GGGCTTGGTGGTTTCCTCCGTCGTCCTTGTACCGCAGGTTGAGGTTGATCTTCATGAATATTTAAATTGCCGAGGGTCTGGCGAATCTGATTCAGCTGCG
AATACGCTTGCGTTTCCGGAATATCGTCCTGATGACTTGGAAGCTTGAACCCATTTCGCACGTTGTTTACTTCAAAGCCCACAGATTGAGCAGGATGCTG
GTAGGAGATAGGCTGGTACTGCTGCTGTTGAGCTTGTTGCTGAGCTAGCTGCTGAGTTTGCTGTGCCTGCTGAGTCTGGAGGTCCGCGTGATGCTGTTCG
TTGAGGGCGCGCTGGGCATCCACAAGACTTGCCATCTTTTCATTCTCCAGTTGCATCAAAGCTCGTTGCACGCGCAGCTCCTCTTTCTCACGCCGTACTT
CATCGCGTTCTCGTCGGAGTTCCTCACGTTCGCGGCGAATTTCTGCCAGGAGTAAGCGATACTCGTCAATAATACGACTCTGTTGCTCCACCTGTTGATG
AGATGCTTGAGCATCATTATCCTGGGAATATAGCTGCCTTCCAGCTATTCCACCACTCAGCATGTTACGATCAAACATGTCGTGGCTGTCATCTCTACTA
TTCCGTCCAATACCTTGTGGCATCTGAATTCGCGACGGAGCCGGAGGAGGTAACAACGCTTCTGTCGCTCCTAGGTTTCCATAGTGACGGTCTCTTTGAT
ACGGCATTGCTTTATCATCCTCCTCCCGCGAGTCAGTAAATGCAAAATTATGGTGGTTGCTCGTCGGCTGCAAGTCGCTCCTCTGTCTATTCGTCAAGTC
TGGAGGTGACGGCATCGCATGATACGGAGCGTTTGTCTCCGTCCTGTTTTCACTTGATTCAGCATTCACAGCAGGTGAAAAGTGTCCCAGCCGTCGTTGT
GCTCGTAGTTGCTGCTCTCGAAGGTATCGCACCTCTTCTTTAGCTGCTTCTTGCTCACTGCGTTTTCGTTCAGCCTCTTCCTGCTCCTTCAGCCGTGCTT
TTTCCTGCACCTGCTCGTCCAAAATCCTCTTCCACTGCATCTGCTGCGCGCGTTCCCGTAGTCTCTGACTTGTTTCACTCTCATCAGTCACCTTAAAGCG
TGGGTGGGACGACGACACGCTGTTTGCTTCACCTGTAGCTGCACCTCTGTCTTGTCGCTGCTCGTCGTGAAGATCCACGCTCTGTGTAAACTTCCAGGGC
GACTGGGAGGCCGTTGGCATGTCCAAATGGCCGCCTTCGACCAGCCACTTGGATGGAGAGCGCTCGGTTGGCGCAAGTTTGCGCTCCAATTCCTCGCGCT
CCATCTGCTCCTGGTGCTGACGCGCTCGGCGCAATGCGATCTGGTGGTCTAATTCCCGTGCATACGCTTCTCGTCGACGTTGAATCTCGCGTGGATCGTC
GTCATGGAGTCCAGCCTCGGAAGCCCACATCGAAGCTGCTCGCGATTGTGTTTGAACGGTTTTAGAGGGAAGCGATTTGATTGGCGCAGAAAATCACGAA
ACGAATTTTGAAACGAATGTTTTTCAACTTTGACAGTTGTGAGTTAATAGTGATCTGATGGAATGGAAGTTGGACGGATATGATGCACATGTACGTCGTC
TGGGCTAGACTCTGGCTTGTTAGAAGTTCAACGAGTTGCCGAAAAGACAGGAATCAGCATATTCACGTCGTAAGTCGGCTATCAGCTTCTCCACTTGAAG
ATCAGAGCGTCGACACTCCGACTGCAAGAGTTGGAACCGCAATGACACGTCGCTCTGGAATCGCTTCAGTCGTTTACGCTCCTTCTTCGCTTCATCTCGT
CGTGGTCGATGGTGACTGCTGCTTCGACGACGGTTGTGGCGACTGTAGTCACTTTCACTGTCACTGGCACTTCCGCAGCTCTCATAATCTTCTTTCTCTT
GAGGCCCACGCAGCATTTTCTGGATACGAAGTCGCTCTTTCCTGCGTCGCCTGCACTGCTCCAAAGTGCGTACAAGTACCGCGTGCTCTCGCTGCAAACT
GTGCAAACGATCCTGCCCTCGTCGAAATGTCTCCTCCTCGCTCTTCAGCCACTGTTTCTTGCGCTCCGCCTCAGCGTAGAGCTCCGCCAGCATCTCGTTG
ACATCTCGGTCGTCCGCGCCATTTGTCTCTCCCCTTTGTGTCAAGCGCAACGTCTGGTTGACGCTTCTATTGCTCGCTCGGGCACTTGACACTTGTTCTT
GTGTGCGCACTCGGAAGACGACCGACTTTTCAGTGGTGCGCACCACGCGACGAGGTCCTCGCTCCACGGATTGCACTGAAGACCAGGTAGGGCTGTCGCT
GTGGTCCCGCGAGTGGGCGCTTGACGACGAGGAAATGGCGTCCTCGCTCATCACTCAACGATACGGTCAAAAGTGATGTGCGAGTCTTCACTACTGATAC
TTTCTAAACAAATATATGGCATTTGGACCACCTAAGTGAAATCGTAATTATTGCGACTCATGAGAAAGATTACCCTCGAAATAATGATATGGCTGCGTGC
TAACGGCTTTGATAAAGTGCAACTTGCATCAAACGTCATGTGATTGTATCTACTACACTTCTAATGCTGCGAGCAGTGCTCAGTGCTGAGCGCAGCAGGG
TCTGCTGATCGGCAACGCAATTTATAGTTCGCCATGCGGGACAGGTTTGCTGGTGGGGATCGGTGAGATCATCGGTGAGAAAATGGGCCGCGAGCTGTGA
ATCAACGCTGTTGAGTGTGCACCGCCTGCAGAGACCTGGCGAACGGGGATCGGGCCGAGATCCAAACGTGTGGGCACTGACAATGGTTTCATGTCCGTCA
AACCCAGTCGTCCGTGGCTGTAGGAAAACAATACGGCAAACGAAGTTAGTCCTTGTTCGCAAAGAAAAATAAATGCACGAAACGTACTCTGGTCGTCCTG
CAACGTAGGCAACACCATCGCTCGTGACAAACAAAGTGTGAGAGCCACCGCACGCAGCTTGAATCACTGTCTTCCCCTTCAGTGCCTTCACCTGAAGGTC
ATAAAAGCTCATGATGTTAGTATTCTACAAGCATTTCAAAAGAATATACAACTCCATACCAAGTGCGGTCGTGTTCGACTCTTTGTATCACCAAGCCCCA
ATCGACCATATTCACCCCGGCCGAAAGCGTAGCAGTCTCCTGACTTCGTTACCACCATTGTATGCCAGCCACCGCATGAAACGCGCCTGTGCAAGTCAAG
TCATTGTCATACGGTTTGCAACAAAACTCCAATACACAAGCAGCAAAACGACAAGCAACGTACAGAGCTGGGATTTCGTCGAAGAATGCTACGCGCTTGG
GGGTCTGCTGGTCAGACGCCTGACCAACACCGAGCATGCCGTAGTCCTCTTTTCCCCAGATGTAAACGTGTCCTTCTTCCGTCACAGCAGCCGAGTGGAA
TGCACCACAAGCAACCTGCACAACCTTCTCGCCATTGAATCCTTCGATCAGATGCGGACGACTAACTCCTAGTAGACCTTCATCCTCTGTGTAGTTTTTC
AACCACGCCGAGCCGATGCCCAACTGGCCGCTATCGCCTCGACCCCAGACGTAGACACGTCCGAGACTGGTCAACGCAGCAGTATGTGTACCACCGCAGC
TGATCTTCACAACATTTTCGCCACCTTCGCCGTCAGGCATTGGACATTTGACTGGCAATGATTCATACGCAGCCTCGAACTCCTTCGGCAGACCAAGCTG
GCCCCAGTGTGACTCGCCCCACATGTACAGCGTTCCGTCATTGGTCACTGCAGCGGAGTGACATCCTCCGCATGAGATGTAGCCCACCACAAGTCCTTCT
TGCTCGAAAAAGGCGATCTTCTGGGGCACATTGATGCTCTTGAGGTCTCCATGACCCAATTGTCCCATCTACAAGCACATCCAGTTAGTAGGTGGACAAG
CACCGGATAGTCAGTCGGTACGCACCGATCCCCATCCCCACGAGTACACAGCGCCGCTAGCAGTGAGCGCCATTGTATGACGAGAGCCACACGAGACTGC
CACGATCTCCTCGCCCAGCAAATCACTGAGTTGCATGGGGAAGTTAGAGGCCGACACGTCGTCGATGGCCAATGTCGGTCGGCGTTTTGCACCCGTGCCC
AGCTGCCCGTCGTCATTGCAGCCGAAGGCCATTACAGCGCACTCTGTGGCGCCAGTCGAGATGCTCATTACGTTGTCGAGTTCTTCCTGCTTGAATGCAA
ATTTGCGAATGACGCACCACATGGTGCTTAGTCTGTGAGCACCGCGTCACTCCAATTAGGTACGAAAGTATCAGCCAATCGCAAGCGTGCATCATGTTGA
AGTCGGTCTGTGAGCACTGCATCACTCCGATTAGGTACGAAAGTATCAGCTAATCGCAAGCGTGCATCATGTTGAAGTCGCTGGCCAATGGACAGTGACC
ATACAAATGGTATGACATGACATTGCCAAGGCACAAGGTCATTATGGTAAAGCATCTTTAACGTCTAAGTGCAGGCTCGGTCGTCTACGGGGACATCAAT
GGATGAGTTTCCTGAAGTTGAGGGAGCATACATTTGCGCTTTGAGGATGTGAAGCTTTGGTCCACGCAGCTTACCGTGCTTGCCCTCAAGTTGGCGTTTT
ATCTCTGCGAATCGAACAGCGTTCGAGTTTCGCGGTAGGTTAGATCTATCCCACGACTTGGTCGTAGATTTCGAGGCAATCTGGACTCCAGTACTGTCAC
TACTAACACTTTGGAGTGAGTGCTGGATGTGTGGATTTGTCTCCGGTCCCAACTCACCTTCATCCTCTTCGTCCATTGAGATAGCACCGTATTTCTTGGT
GACGAATGAAATATTGACCTGCTGCACAATCATCCTGGTGGTGCGGTCGATCTGAAATTGCTGCTTGTATTTGGCCATCAGTCGTTGACGAAAAGCTGCT
TTCATTGTTTGCTGCTCACGCGTCACCATTTCCTTGCGATAGGATTCACGTTGGGCTGGATACTTATTGGTCACTCGCAATGCTTGGCAGCGACGACGAC
TTACAACGCCACGGACAAGACGCTGAATTTTTATAGCTGGAGACTGTCGAATGCCCTTCAACCATCCTTTCTGCCGCTTAAACTCGCGGAAGACCATTCG
TGTAGCAAGACCCCGCCACTGTGCTTGAATGCGGCTAACCAACGCATATTCACGGCGCAGAACACGTCTCGTAATCTCTATCACGTTGTTTTCCACCTGG
ATCAACGAGGGTCTGCCACCCGACCGACGTACATATTCTCTGTAATTCCAGTAAAACACGCCAAGTTCCGCGGCGTTGGTGTACCAGAAGACCGGTGGAT
CGTTTGGCCGAGCGGCCAGCGCGTAGCTAAGAATTTGTGGAGCTATAAAGCGGATTATCCGCAGACACCGCTCGATGACAGTTCGCCTTCGTGCCTGCAT
ACCTCGCACCCGCGTTTGAATTCTAGTAGCTGCTCGCTTAATCTTGCGTAAATATCGTTCACGTTCTACTAGACGACGGCGAAATTCGAGTCGCCCGAGA
AATCCACGCGCAATGCGCTGAAGCAGAGCAGTGGCAGGGCCTCGTCGACGCTCGAACTCCTTAATAGCATTTCGTTCTTCCTCAATCTGTTCCTGAAAGC
TTACAACTCCTGCTCGTAAATATCGTGTACTTCCACAACCTGGACACTTTGGCACTTGTTCATACAGAAACGTGGAGTCCTCTCTTTCGCCAGCTTCGTT
GAGTGGTTGCATGGAGGCAGCAAGTTGGTCTACTTTTCGCCGCACTCGCTGCACATCGACGAATGTTACGCTGTTGCATCGCTGACAGGTGAGATATGGT
GTCATGGAGCTGAATAAGTCATCATAAAATATCGATGAGCTAGTCTTTGGTGTTTGGTTGGCATTCGTAGAACTGCTATCATCGGACGATATGTCGGTAG
CAACTGCTGCAGGAATTTGCAGCGCAGTAACTTCAGCATCGAGATGACTCTTAGGTTGCTGGTTGATGCTTAGCGGTGAGATAACTTTTTCCTGTAGGGA
AGTTTGCGGCATGATCTCGATTTCAGGCGTCAAAGCGGGTCATGTGTGTTGTTGGGTCACTTGTCTAGTGCGCCGTTTTGATAGGATTTTTCAGGATGGT
AACGCACAGCGCTGCAAATGGCAAATACATGTAGATCCTGATGGAGAGTAGAAGCACAACTTGTGCTAGATGGATAGAGCAAGAGATAGTTGTGTTTCAT
TATGTCAAACGCTGTTATGCAGCCATGCAAGGTGCGACGCTGCTTATTCATCCTCAGCGATGTCTTCTTCCATTTCATCTTCGACGTCGTCATCGTCATG
ACGGACCATCTTATCTTCACGTGAGTTTGGACGACTCATTGCTACCTCGCGTGAGCCCGGGCGATTACTATGAGCGTCTCGCGAACTTGGGCGACTTGCG
TCACGAGAACCAGGTTGGCCGGATTTGGCTTCACGTGAGCCCGGGCGACTCGACGGAGCAGACTGCTTGTAGTCGCTGGGTGGTGGTCTACGGTGTCTGT
CGTCTCCCAAAGAAACGCCTAGCTTCGCTTGGACAGCTTCCACTACTCGAGGGTTCACGTACGTTTTGAGTGTAAGTCCTTTTCGCTTCATCTCCTCTAA
AGTCTCGAAGCTCTTGTTCAGGTCACCCTCTTCATAATAACCTTCCACCAACATTGCATACCCGTCACCCACACGAATAGCTTCCTCGATTCCAGGCTCC
TCCAGCAATTTCGTCACAATGTCCATCATCTCCTTCGGGTTGTGCTTCGCCTGCTGACGAGCCAGAACAAACTGCTCAATGAGTAAAATACGCTTCTCGT
ATCGCTTCAATAGAGCTTCCTTGCCGTCTGCGCGAGATTTGGACACGACCTGAACAGCTTCTTGCAGCGCGGAAATCGCCTTCTCATAGTCACGATACTC
TTCAATCTCAACTTGAGCACAACCAGCGTAGAAAGCTGCAAGTTGCTCGAACGCACGCGCTTTTGTGTAAAAGCCAACAATATTCTTCATGATTTCGGTG
TCCTTGCGCCAATCCAGATTTTGGAGGTAGTTTGCCGCGAGAACGAAGATTTGAGCGTTGCGCGATACGTTGGCAAAGAAGACTACTTTTTCAGTGTCTC
CAGACTTGAGCAGACATTTCATTGCCTTGAGCTTGTTGCCGGCCTGGGTATACTTCTTTGTGGCCAAATGATATGAGCCTTGTTGCTTGCAGCGCTTGGC
AAGTTTAAGAAGTAATTCAGTGCGTCTCTTCTTGTCTGCCGGTGTGGCAGTGTCATCACCCTTGGGTGGAGTCATCTTTTCTGCCATCTCTTCTGTGACC
TTCACATCGTGTTGCATACACACATCCAGTGCCTCAGTCATCCGGTTTCCAATCAAGCACAAGTGCACAGCCTTGGCGTAGTGACCATTTGCGATGAAGA
AGTCTGCGCATTTCTTCAGAATAGCAGGTGATGTATTCCCAGAGCCGCTGAGCTCATCTGTGAGGTGGTGCAGCTCTTCAAAGAGCTGCGCCTGAAAACA
CAAGTCCAGGGCTTTGGCCACATTGCCTCCTTTGTTGTAGAGCTGGACTGCCTTCTCCATTTCACGCTGCTCTTCGAAGTATGCAGCGCAGTCGAGCATG
TCAGTAGGTTTGCTCATGAGGGCGAAACCCATGAGATCGGCATCCATGCGGTGGTCTTTTGCTAGTCGAATCGCATGGTTATAGCAGCCACCGCTTGCGA
AAAAGTGGATGGCGTTGGAGATCTCGTTGTGTGCTTCAAACTGTCGGGCCAAATGGTAGGCAGCTGCACGGTTTCCGCTTGTCTGTGCTACTTTGGCAGC
ACCCTGAAAGTCCTTCTTAAAGCATAGGACACGAACGATGGACAAATAGTCTTTGGCGCGTTGGTAACTATCCACTGCCGCATCAAATTGACCCTGACTC
TCTTGAAATTGAGCCCACCAGATCAGTAAATCACGGTTATTGGAGGTGGCCACGTACTTTTGCAGGAGATCGATCTTGCCCAGTTTGAATAGCATTCTTG
GGATGTCTTTTTGATGAGTACCAGCATCTTCGTAGGCTTCCATCGCTTCCTTGAGCTCGCCCATTTCTTCATAGTGTCGTGCCAGAGCGTAATACGTTGC
TTTGAGATGAATGCGGTCGCGCTTGATCGCTACATCCACGGCTTTCTTCCAGAAACCACTGGCTTGGTACAATTTATTGAGCAGGTCGTAGCGTCCGCAC
TCGCGGTACAGACGAGCTGCATCATCACGCAGACCTAGCTGGATAGCAACCATAGCGATCGCCACCTCCAGTTCAGGTTCCTTTTTGGCCTCCTGCACAG
CAGCTGCACCACGAGCATGACCCATATTTCCGAGGCATACCTCAGCCACATCTAACCGTTTCGTCTTCACGCACATGCGCGCCATATTCTCCCAGACGGA
CGGATTTTCAATCAGCTTGACCGAGCGGTATGCCTCATCCATATTGCCAACTGTCATAAAGTAACAGAAGTCGATGAGAGCTTGTTTCGCCTCGTTGTTG
ACTTTGTCCAAACCCGTGAAGTCACGCATGATCTGTGTGCGAAGGTAGCTAGCAGTGTCGTAAAGCGTTGGGGCTTTCGTGGTGGGATTATTGGTCTTGG
TTCGACCAACGTGTACTATATTGGCGGAGTCATCCGATGAGCCATTATCCACCTTTGCGACGAAGTACACGCGTGGGACTTGAATGCCTAGCAGTGCAGT
GTACTTCAGATCAAGGTCAAAGTTGTCTTGCATGAGAAGGCCGTGCTCGTTCGACGCGAAAATGATAGTGACTTCCTTGTCTGAGACTTGGCTCCCTCGG
GCACCACCGCCTGCCCCAAGTCCGTCGTCGGTATTCAAGTCTCGGCGGCCAGCCGCACTACTTGCTGCAGTGGACACACCATCGTTGCTAGACTTAAAAG
TCTCACAAACGAGTAAGCGAGGTTCTTGTGGATCGAAAAACACGGATGTTGGGTAGCGTGAAGCCCCAAAGTCGAACTGTTGATAAATGTTGAGGTCTGT
CTGGAAGAGAAACAGTTTGTTCAGTGGCTCACGCATTCTCAAAGCGCCTTCAACACGATCAGCAAGGATACAAATACGTGTACCATCTGAATTGACACAG
ATAGATCGCATCACGACAGACTTGGTCTCTTCACCAAAAGCGTCGGGGAGGTTGCCCATACTTCCCAGGGCTTTTGGGTCACGGCGGGATACATCGAACA
CGCGGAGTAGACCACGATCTGTGCCTACTGCAAGGAACTTGCTCTGTAGTGATAGCATTGCTGGTCGACCCTCGGCCTCCGTGAAGGATATGGTGTTCTT
CACTACCCCTGCAAGGTTGCAGACTTCGACGTGGTTTCCATTCGTGCGATAGATAGATTCACCTCGTAGCACCATGGAGCTGGAAAAGCACTTAAACTGA
TTCGTGACTCTGGCATCTCCATCTTTTACTTCGTAAACTTCTGCTTTTGAGCCGTTCCAAACCACGAGCATTGATCCGTCGTGCGAGACCCCTTTGATAC
GCAATGACGCATCAAGAGTTGACTGCGTTATGGTCACACCGGACTGCGCTCCATCTTGGAATTTCTCAATTGACAATGTGTTGGGTCGCACTTGAATTAC
TGCTGTATCACCACAGAGTGCACGTTGCATATTTCCCTCGTGCAAAATGACCACGCCTTCGACGGTATTCGCATACAAGGCAGGGTGGGCATTACTCCAG
CCAATTCGTGTGATTGCTCGCCCCACTTCAGCCGTGAAAAGCAGGTCCCAGCGGTAAGACACATTTGTTGACTCAGTGTTGCCTTGAGGAGTGTCAATGA
AGGATGTGGCGCGCCAGAAGAAAACTGCTCCCTGGGCCGTTCCGGCCACCAGCACGCGCTTTCGCGGAGAAAAGCTTAAGTTGTTAACATTGTAGATGAT
CCCACTTGACTTAGGCAGACTCAGCACGCTGTTTTCCTCGGTGCGAATGTTCCAGAACCGTACCAGAGGTTCACCAGACGCGATAGCTAGTAGTCCAGGG
CTAGCCCATTTCGTTTCAAGCAGTGAACCTTCACCTGCAAGACTCAGTTTGACCTTGGTAATTGGCTTCACCGTGCCGTCCGTAGCACCAACTTGATAAA
CGATGAGTTGCACAGCTCGAGTGATAACGATCAAGCGGCTCTGTTCTTCGTAAAACATCATCGACTCGATAGCGTGATTGAGCACCTGAATGTCCGAAAT
GTGGCCCAGGTCGTCGGCATAGTGCACAGACCCTACCTCACCACCAAAGAAGAACTGGGGGCATGCATGCTGCGAGAACGTCTCACTAAACAAATAGATT
TGAGTTAGAACAGGTCGGTAAGTCAAAGAGGTTAGTTACAAATACCTTTTGGAGTGACTATCCTTGGGTCGTGTGGCAAAGACGCAATGAGTGAAGCTCC
CTTGGCGTGCATATTGCGTACTAATCGAGAGTTGGCACCGACTGTCCACCTTCCAGACGGCGAATATCCCATTCTCATCGGCGGACATGAGTCGGTTGCC
CGATGGCGCCCATTTCAACAGGCGCACACGACTCGAATGCGGGGAGTTCACCTCGCGTGCTGTTTTCTCCTTGAATACCCACAGCGAGACCATTCCTGTA
ACAATGTTAGTGAGCATATCACCCAACTCATCGAGTACTACAGCTTATCCATGCAATATACCGTCACTCCAACCAACTGCGAGTGCTCCGCCGTGAGGCT
GCCAAGCCATCGTGACAATGTCGGCACTGCGCGAGTAGCTCTCCAGTCCCTGCTGCTTCTCGCCCTACAGAGGGTTAATACACCACACATCAATGTGATT
TTCCTATTTCTTGGCTCAGTCACTACGTCGGTACCTCATCTGTAAAAAAATGGATCTCTCGGTTCTCCAGTGCCACGGCAAGCACGGGATCCAGTTCACC
CCAAACTGAGCAGACTTGCCGCAGATTGGCTGGCACCGCCACATTGTAGTCGTAGAACAAGGCCATCCGTCACTCCGCTGGAATACTGGTAGATCGCCAT
TGCCATTGAAGCGACGCGTCTTTTCAAGATACAATGTGTGTGCCACACGAAACGAAGTTTAGTCCGACACAAATGTTGTCATTTGGTCCTTGCGCGAAAT
CTCGTCTGGAAAGTAATTTGGTCCTCATCAGTCGCTAAATCTGGTCCTACACAAATACTAATTTGGTCCGTAGCAATTGACTGGTTGCCACGCCAGTGCG
CAAGAGCTCGACAGAGTGCAGTGACAGACATGGCGGTGCAAGCGAAGACGTCGGGCAAGAACTACAGCAACAAGGGCGGCTTCAACGCCAAGAAGCGCCC
GGCTGCCAGTGGAGAAGACGGCAAGAAGTCGTTCATGGACCAGAAGCTGGCCAAGAAGCAGCGCAAGATGCAGTGTCCGCACTACGAGATGGTCACGCGC
GCCAAGCAGATCTGGAACGTCATCCGGGAGCGCGACGTGGACAAGACCAAGCGCGCTACACTCGTAGACGAGCTCTACACGCTGGTCAAGGGCAAGATCT
ACGACGTGGCAGCCAAGCACGACGCATCGCGAGTCATCCAGTCGCTCATGCAGCACGGCAAGCCTGAACACCGGTCGCAGATTGTGCTAGAGATGAAGGA
GCACCTCATTGAGGTAGCCAAGATGCAGTACGGCTGTTTCCTTGTGCAGAAGATGATTCGTTACGGTAGTACGGCAGACCGCGCAGCTATTGTCAAGTGC
CTCACGGGTTACGTCGTGCAGGTCGGCACGCACAACATTGCTGCCAATGTACTCGAGTACGCACAGGAATATCTCAAACCGTCGCAGCTCACGGCACTCA
AGTTGGAGTTCTACGGTCGTGAGTTCGCCTATTTCCACTCGGAGAGTAAGCGCAACCTTGCGAACATTATCGCTGCTCACCCGGAGAAAAAGGCTGATGT
GCTCAAGTACTTGACCACCATCTTGAACCGCATGGTGGACAAGCAGCTCCTAGGTCTCGCATTTGTGCAGTCACTGCTGTGGGAGTACATGTGCAATGCA
GAGCATGACGATGTGATGCAAATGGTGGCTAATGTGCGCGATGCGTCATTGGCTCTTCTTGCTACGCGCAATGGTGCTCGTGTGGTGAACAAGTGCATTT
CCCTCGGTGCTGCTAAGGACCGCAAGCGTATTATTAAGGCTCTCAAAGACAAGGTACTGGAGGCGTGCAACCATCCTAGTGGCTACCTTGTGATCATGCG
CATTTTCGACGTGGTTGATGATTCAGTTCTTGTGCAAAAGTCCATTCTGGCGGAGATGAACGACGAACTCTTTTCGATTGCTATGCACCCTAGTGGACGC
AAAGTTCTTCTGCAGCTGCTTAGTCCTCTGAACAAGAAATACCTCTCGGCGGATGATCTTGCGCTGCTGGAGCCCCCCATGTTGCCGTCGCCTGAAGACT
CGACCGTCATGGTGGTTAACTACAAGAAGGATCCGGACGCTCGTCGCGAGGAATTGCTGAAGGGTTTGCTGCCTAAGCTGGAAGAGATGTGCGCTGAAAA
CGCTGCTGCTCTAATGCGCTCGAAGGAGGGGCGTGATGTGATTGTCGAAGTTGCTAAAAGAAGTGAGACCACGGAGCTGGCAGATAGCGTGGCTGCCGCT
GTTTTGGAGGAGCCCACTGAGGAGGAGCCTCTCTACACTGATGCCAACGGCCACTACGCTTTGCGTCGTCTGATCAAGGAAAGTTTGCTGGTGGAACCTC
TGCTCACAGCCGTCGAAGAACAGTTGCCGCAGTGGGCGACCACTAACCGTGGCTCTTTTGTAGTCCTCGCGTTCCTTGAGGCTGAAAATGCTCCCAAGAA
CGCTGACAAAGTGGTGAAGAAGGCGCTGAAGCCTGCCATGGGAGACCTGAAGAAGCTCATTGACACGCAGAAGGGAACTAAATTACTTCTTGAGAAGCTC
CAATAGAGAGGAGATAGCTCAAACTTTATAGATCGAAAGGCATGTTGTTTTTTATCACCGCGTTGCTGCACGCACTATTGCTTGCTTTTTAAAGCACTCC
ACTACTCAGTCACCCTCTTCGCTGCTATCGTCGCTATCACCTGACGACTCTGTACTATCATCGTCGTCCTCTTCTTCATCCGTATCATCATGGGATGCAA
GAATGGGATTTCCTTCTCTCCAGTTTCTGACTAGGTCCAGTACCTTCGGATGTGAGTGAAGAGCAGCAAGGTATGACAACGTTTCGCCGAACTGTTTACA
TGCGCATTCGTGTTAGTTGACAATAGATTTGTAAACGATTTTGCGAGCCTCACCTTGTTTGGCTTATCAACCAACTCAGCATCACACTGCTGGAGCATGT
TCATCAAGAGATTCACACTCCCGCAAGCAGCTGCGTAGTGCAAAGCTGTCATACCTTGTGCCTATAATACCATACACATCACTGTCAGCGATTGTTGACA
CTTGGATGCTTATATAACACGTACGTCTTGTAAAGTGAGATCCGAGCCAGCATTCAAGAATACCATACCTAGCTGATGGAGAGGTGTACCTCCCTCGGCA
CACAGCATCAACGACGTCTGTCCAAATACCTGTTCGAGTGCAGCATACATGGTCAACACCATTTTCCAGTGGTTTATCCCATTAAATATGACGTTGAACA
CCTACATTTCGTGCATCAACGGAAGCGCCCAGTTCGATAAGAGTTTCCGCTGCGAGCTTGCTTTCACCGACAACCGTTAACATTAATGGCGTCGTACCCC
ATCGGTCTTGAATATTCAAGTTGGCGCCGTACTTGGCGAGAAGGCGCACGATGTCCAGGTTACCAACCCGACTAGCCCAATGTAGTGGTGTCCAGCCATC
TCTCTGAAAAATGAACAGCGCTACTCCGTTATCTGCTTAACATTGAAACCAGCTCGACACGTACATCTTTCTTACTGATCGACGCTCCCTTCTTCAGCAA
AACGTGACAAATACTCGTTCGGTGCAAGGTGCATGCCCAGTGCAACGCATTTCTACCATCGGAGCCATTTACGTCAATGTCGATCTGATTGGCGATACCC
GAAAGGATCTCATCCACATTGTCTACTCCACCGGGTGGACATCAAACACTGTAGACATCAGTTTTTTGGCTCTCGAACCTGCATGGAAGTCATCCTTACG
TCCTTACCTGTTTTCGCAGCGAGAGTAAATCCATCGGCAATCCTGCCATCTCGTTTGGCTTCCTAGTAATCCCAAGCATAGAAATCAGGCATTTTGGAAG
CCGCAGTGCTGGAAACAGATCCTTACGTAGTAAGAATGTGAAAGTCGCCAGAGAAAGAAGGTGAGAGCAGCAAACGGGATAGCAGCTATGGCGTACGCGT
ACGTTGAGCCCATTTCAATGCAAGTGAACGTATTGATGCTCATCACATTACGACACTGGTCGTCATACTCAGTCACCATGCGCTGCCACAGCACGACGGC
TGGTATCAATACCACCGTCTCGACTAAAGAACACAACACGGGGGTCACGAGCGTGGCCTCCTTGCCTTCCCCATTCCACGTGGGGATCTTAATGTCAAAA
GCCACCATGACGCTTAATATGAAGCTGACAATGGCGGCCATCAGTGCCAAGACAACGAAGGCCCTCGTAGCCGCGGCATCTCCTAAACACCACGGGTCAC
TAGAGGCAACAATGGAGAGCGAGCTGCGTATGATGCGTTGGTTAGCACGGTTTTAAGCAGGAGGAAGGCCACCTTTAGTACCAGAAGCGGCTGTAGAGCG
TGACAGGCTGGTCTGCCGAGGTGACGTCGGTACTGTCGACCGCGGCGCCTGCGTTGATGAGTTTGTAGCGCACACCTGTACCCTGAACGGAGGATTCAGT
TAGAAAACGATCAGGAGATTCGAGTTGTCGCTCGTACTGTGAGATACCAAAGTCCGATGTCCACGGAGTTGACGGCGTCGCGAGCCCATTTGTGGCCGCT
GTTCGCCGCCAGCAGCAGCACGAGCGACACAAAGCTGCACACGTTGCCTGTCGGTGACGACGGTGAAGGGTTAAAGCGTATGCCAGCTGGGCATTCGACG
AGAAACAACGCACCGAGCAGGAAGCGCACGCGAATCTTCATGATGCAAGATGCGTCGCTTAAATATGGGGATTTCAGCTCTACCTATGGCCGCAAGAGTT
ATTAGGCCTCAAGTTCTAGAATCCTTTTGGCTAGCGTAAAAACGCTAGTAAAGCAGAATAACTAATTAGAGTTATTCTGCTTTACTAGTGCTCCGGTAGT
GCCTGTGTGCGAAGCGCTCTACGGAACTATGCATTGGGAGGTCAGATGCAACATCGCGGCGCAAGATACGCATTGCTCGGTGAAATTAAGCTGTCAGATT
ACAGCGCTACGATCATATTAACTAGTACTAGTAATTGTTTGACAATGTGGCAAGTTGAGTCGGGCTTCGGTCTCCCAATGTGAACCTTCCAAGATTCACT
GGGTATACAAGAACTCATTTGTTGCATGCTGCAGCTTGCAGCAGCGAATCTCCACGACAAATCGATAGGAAACACTGCCCTGTCATTAGCAAAAGGAACC
CTGAGGTAGCCGGTCCAGCCATGCAGACTCACAAATTGGTCGCCGCTCGAAATGAGCTCTTGTTGAGTGGACATTAGGTATCAAATGCTCAACAGAATTC
TGTGATCATGTAGCTCGCATAGTTGCTTGCATAGTTGCCATGCCGGTTGCCACATTTTGCGTTTTGCGTTTGCCATATTTGGTTCAAAGAACTGGACTGG
TTTTGTCGCACGCATCCCTAGCCCCGCAAGATTCTCTGGTGCATGAAAGCATTCAAGCCTGGTTTATTTCTCGTTAATCGAATCTAGATTCAAAAAAAGA
AAACCACTGCGCTTGGGTATGGCTGCCCGAGAAACGCGCTTCGCCGTTCTCACTTTCGATTCCGCCCTGTCGAGTGCAAGCACATCATGAACCTCCAAGA
CCTCCTCTCCGAAACTGCCGAGTGTCCGCCGTCGCCTACTCTTTCGGTCAGTAGCTGCTCGAGCTCGAGCTCGAGCTCGAGCAGCTCGGAGGCCCCAAAG
CGCGGTTGGGTGGCTCCTTTCCTGCTCCACCTGCACAAGATGCTGCAGCACGAGGACTCCAAGATCATCCGCTGGGCTGAGGACGGCATGGCCTTCCAGA
TCCTGGACAAGGAAGCCATGACCGCGCAGATCCTTCCCAAGTACTTTAAGAACAAGAACTTCTCGAGCTTCCAGCGCCAACTCAACTACTTTGGTTTCCG
CAAGTGGAGCAAGGCCCGAGCACAATTCCCTACCTACAGCCGCGAGCACTTCACACGTGACAACTTCAGCGAGATGTCGCTGGTTAAGCGCCAGAGCAAA
AAGTCGCGAAAGCGCAAAGCCTCTTCAGACGAGGAGCAGCCGCCCAAGCGCGCAGCTGTGGCCTTGGCTACTTTCGCCTCGGAGAAGTGCAAACCCATTC
TCCCGCGCCCTGACGCTGTGGCTGTTCCAGCATCATACCAGCCTCAGACCATGTCTCCGCCAATGCACTCTGCACCGGTGTTCCACCTCCCTGTGCTGTC
TCCCACCCGCAAGATCAGCAGCGGCTACAAGCTCCCGTCCATCCGCGAGCTGTCGCTGTCCAGCGCAATGCCGTACGCGGTGATCAGCCCCATTAGGCCC
CGCCTCACGGCTTAAGTGTCTGTCGCCGTTTGTATTTTATGGTTAACTCAAGCAACATTATTTATACAATCCACTTCCACCACATTCAGTCTTCTGCATT
CCAAGTCCGGATAAACACACGGGACATTTCTTTCAAACGTCCCGTATATCGCTAAAATCGTACTTAGTGGAGGCACGCGACCGCTGAGTGATCATCGGCA
CCACTTCAAGTTTCTCTCTGCAGAGGACGAGGCATTCGACAGACACCTCTTCGCGGCCGTGTTCTCATGTCGAAGCTGCTGCTGCTTCTAATTGCGTTAC
CGCTGGCAAAAGCATGCACGATGATCGCGGTGGGACGCAACGCGACGGTTGACGGCTCCATTCTGGTGGCGCATACGGATGACGCAGGTTTCGGGGCTGC
TGACCTTCGGATGGTGCGCGTGCCAGCTCAAGACTACGAGGAAGGAGCGATGCGGCACGTGTATAACGTTCAGCCAGGCTATCCGCGTATCGTGACGACC
CAGCGAGGACCCGAGTACAAACCCAAGAACGACCAAGAACAGCTCATGACGCCACTTGGGGAGATCCCGCAGGTGCCACACACGTATGGCTACTTTGACC
AGGACTACGGCTTTATGAATGAGGTGCAACTGAGCATTGGAGAGAGCACAAGCGGCGCCAGGACGGTTGGCTGGCCCAAAGACGCTGGCCCGCACGGATA
CAATGTGTTCGGGATTGGAGAACTCACCAAAGTGGCGCTAGAACGATGTGACTCGGCTCGATGTGCCATTCAGACCATGGGTGACTTGGCTGTCAAATAC
GGATTCTATAGCGAAGACAGTGGTGATCCAGCCAATCCAGATTACGTGAGTGCCGCGGAGACTCTGGGTATTGGAGATCGCTACGGCGAAGTGTGGGTTT
TTCATGTCCTGACGGGTCCACAGAACACTAGTGCTGTTTGGGCTGCCCAACGTGTTCTAGATACGCACGTGGTCGTGGTGGCTAATGGTTTTGTGATCCG
TGAGATGGACCTGGATGATCCAGATCACTTCATGGCATCAGAGAATGCACTTTCATTTGCTGAAGAGATGGGGTGGTGGGACCCGAAGCAAGGCAAGTTC
GATTTCACCGCTGCATACGCTGCTCCAACGCCAAACCCCGTACGCGCGTTGTATATGGGTCGTCGTATTTGGCGCGTGTATGATCTTGTGGCACCGTCCT
TGCAGTTAGATTCTCGCCTTGGGCACTATCCAGAGTTTTCAACCTATCCGTTTTCGGTTGAACCGGACCGGAACCTTGATGTGTCGGACGTCACACGGTT
GTTACGTGATTACTTTCAAGGCACACCGTACGACTTGTCTAAGGGCCTTGGTGCAGGACCATTCGGGAATCCTATGCGGTGGGGAGGCGACGAGAAGGGA
GTCGTAGGTGGTTGGGAACGACCAATTTCCATGTATCGTACTGTCTTCAGTTTTGTGCTGCAAGCTCGTGCTCACCTTCCTGATGCAGTTGGTGGTGTGG
CTTGGTATGGACAGAGCTCACCGCATGCCACAGTATACGTGCCATTTTCCTGCGCGCAACAAGAAGTGCCACCCGCATACGTACTTGGCAAGGAAAGTGA
GTTTGTACATGGATCAGCCTGGTGGGCCTTTAGCTTCGTGAACAACTGGAGCATGTTACGTTTTAACGCTATTAGCAAGGACGTTCGTGCTCGCATTGCT
GAGTTGCAGAAGACTTGCTTTATCGAAAGGAAGGCGATGGAGCACCATGTCACTCACACCAAGTCGTTAACCGCATTGGACACCCGCGTGTACTTGCAGG
AGCAAACTAATCGATTGGCTTCGCGAGTTATCGAAGAATGGTGGACCTTTGCATGGAAGCTTGTGGGCAAATACGCGGACGGCTACATCACCACGGGCGA
AGCTTCAGAAGAAATGGAGATGCCTGGTTACCCAGAATGGTGGCTCAGACTTAGCGAATTCTCTAAATGGCCAGGCGAGACGTTGGTGCCACCGCATATT
CCAGCTTTGCAAAAGCAGCTCGAATTGTTTGAAAGACGTCAGAACGTGAGCGCCGAACTTGAGACGCAGCAAACTGACAGTACATCGTCTTCGAGCACTT
TTTTAATTCCTCAATTTGGAATCGGTGCTGTTGTTGGGGCTGTTATGGGTGCTTCCGCGACTTGGTTTGTTACGGAGCGTCAACGGCGATCCGGATACCA
GCCCCTAGCTTAGATGCAGATCGGGTGGATGAAGAGTTCGCATGCTTATAATTTTTTAGGTGTTGGATCTAGCAGAGCTCCGACTCCTACGGTCGGTGAA
GGTGCAGACAGATTATGAACTGCACTAACCTGCTACAAGAACAGAAAGTACCCACAGGTATTTTTCAATCGTACGTGTATACCGCTTACCTACCATGAAG
ATTAGTATCTCTTGTGCGGTTCCTTGTAGTTGCGTTTGTTTGCCGGACTCGAAGAACGCTTGTGTCCATGAGAACGTCCTTCACGTCTGTTGTTGGGTGA
GGAGCTTCGGTTGCGGCTACTCTTGAATGCCTGCTGACTTTGTAAAGTCTTGGTGTCATTGTCGCTGAACGTTCTCCATAAACTACCTCCTTGTTTTCCG
TTGCCTTCGTAGTTATCCCGTTTCTTGCGTCCGTGAATCGATTCATAACTTCCCCGATTTTCGTTGGTAAATCTCTCGATCTCTCCCGGACTTCTTGACT
TGGATCGTCCTGCTCTAACAGGCTTGGAAGCGGCGGTAAGGCCTGGAGTGCCCATTAATCCCATCGCTCGCAATGTCTTCTTCTGCAGCAGCGGGACTTT
TTCTAGTCCAATGAGCTGGCTGTAGAGAGCACCCGTTTCAACAAGCTTCGCCTTTGACATACTCAGCTTCTTGAGGTTCGAGTTGTAGAAACCCAAGAAT
GCAGCGTAAGCCTTCTCAGCCGATTGTTCCAGATCACTGTGAGGACGAACATTTACAAGGGCCCGTGTAGTTCGGTAGTTGTGTTGATCCAGCTGAGGAC
GCTGCTCAAGTTCTGTAAGCGGCAGGTCAGCCAGATCACGCAGCATGGCCTTTTCAAAGTCGGCCAACACTAGAATACCACGCCCTTCCATACCAGCGCG
AGCAGTTCGTCCAAGGCGATGAATGTACTGGTCACGATCCGTTAAGCCCACTTGCAGTACAAGCGATACATCTGGGTAATCAACTCCACGCGCTGACACG
TCAGATGAGAACATGATCATCTTCTTACCCTTACGGAAGGCATCGGCGGCCTTGGTTCGGGCAGATTGACTCTTGCGTGAATGCATCTCCAATACGTCCT
TGAAACCCGCAGCTTGAAAAAGTTGCGCCATGAACTGCGCAGATCGTGCAGTGGGTAAGAATACAATAACCTTGTACGCCGGCAACTTCATGTGCTCTTC
TAGCACACCTTCCACAACAGGAATGACGTCTTGCAGGTCACAGACAACATATTCTTGCACAGCTTGTGTGTTTGTCTGTTGATCATCACCTTCAATCGTA
TCCACAAATGTGTAGTCGTCCCGCAGTGCTACATCCTTAAGTTCTTCAGTGGCAACCGGCAGCGTCGCGCTAAAGAGCAACGTCTGTCGCTCTTTCGGTA
AATGGCTGATGATCCGCATAATATCAGGACGGAATCCCATGTCAAGCAGTCGATCAGCCTCATCGAGTACAAGGACCTGAAGATTGTCGAGCTTCTGTCT
GATGCGTCCACTATTTTCCTCTAAATGCGCTTGCAGTCTCCCCGGAGTGGACACAAGCACATCGATACCTCCAGGTTGCGTCAGCTCCTTGACATCTTTG
TTCACTGCACTACCTCCCACAAAACAGGACGTGCGTAGTCCATGGGCATCCGTGAGCTTCACCGCTTCGACTGCGATCTGTTGTGCCAATTCTCGAGTTG
GAGAGATCACAAGAGCCGAAATCTTGCCCTCTTTAGGCTGCGGGTACTTCAGCATGCGCTCCAATGTAGGCAACAAGAATGCAATGGTTTTTCCATTGCC
CGTCTTGCCCTTAGCCAACACGTCGCGACCTTGCAGTACCAATGGCAGCGTGTCCTTCTGCACATGTGTCAAGAACTCGTAGCCCATTTCACGAGTCAAT
ACATCCTTGGATCGCTGGCTGATTGGCAGAGACGCAAACGAAACATCAGACAAATAACCACTAGAAGTCCATGGGACGAAGCTCGAGCGGAATCCATGCG
CAGTAGCTCCACGCAACAAGGTCGACGAGATGTGGCGTGATGTCCACATTGTCGAATGGTAGGTCTCAGACAATAGCGGTTCGAGCCCAAAATAACCTCA
TTTCGGTATCTCGAAATATATCGTTTTAGGTAGATGATATTTTTACACGGCTGAGATTGGTTGAAAATAACACAGAAGCCCTAGACTTGGATCTTAATTT
GGGTTCCCGCTCATTGTCCGATTGACGACAACCTGCACACTAAGAAGACCCGAGCAGTGACAATGGCGCTCGGACTGCTGCGTGTATTGGCGGCATCTCT
CGCTGTGTTGGTAGCGATGTCTACTCCCTCCGACGCTATGATTGTGAAGCTGGATGGACGAGTGGAAGAATGTTTCCACGAGTACGTACGTACCAAGCGC
ACGGCTTTCATGAAGATTGGCGTACTGGAATCCACAGGCGCCTACGACGTGCGACTGAAGGCGTTCGGCCCATTCCCCGAGTACCCAGAGCAAGAGCAAG
TGGACAAGAACTTCTTTGACCAGTTAGTGCTCACGCCCCATGACGAGGTGAGCCAGAATGTCGAACACAGTGGATTCAACTTCGAGTCAGAGCACCGCGG
TGGATGGTATCGCTTCTGTCTGAACAACATGCACGACGGCCAGATCAAGACGATCGAGTGGTACACGTCCTTTGATCTATCGAATGAGGATGATCTAGGT
GAGGAGGACAAGCTGGACGCGCAGATTCGTCAAGGTACGTCTTCGAATTGGAGGATGGAGGGTTGGAAGTATTACTGACGTTTTTACTTGGTGGTAATAG
AGCACATGGAGGGCGTGAAGACGTCGCTGGACCGATTGCAGACGTTGCTGAAGCTCATCCGTAATGAACAAGACTATTACCGTGCTCGAGTACACCGCCA
CGTTCAGAGTAAGCTTCATGTTGATAGATTTGCGCCGTAGTGATGCTGCTGCATGAACTAACGTGGTTATTGTGGTATAGCGATCGAAAGCAGTAAGAAC
CGCCTCATCTACTACACGGTGTTCGAACTGGCTGTGTTGGGCGCCATGTACGGTGCGCAGTCCTTCTTGCTTCACAAGTGGTTTAGCGATCGCGGATATC
TCTCCAAGCGTCAATGGGCATAAAACTACAAGGTGGAAGTGCATCATAGATATAGGCAACGTTGTATTAACGTTACTGTCTTTGCAGCTAAAGGGAAGGA
TGTGCCTACAAACTTAGCAAAAGTCATTGAAAGCAGTGGCGTTAGAGACTCCCAACACCAAATACGTTTTTGTACCCCATCTTGTTTTATTTGATCCACG
ATAATTATTCTTGCTGCTCGATCTATCGATTAATCATCCAAGACATCACTTTCGACCTCCAGCTCATTAATAATTTGTTGGCAATGACGTCGACGCTCTT
CAGCCGTACTTGTATGTCCAGCAGCAGACACAAATACTTGATATGCAGGTTCACCTGCACTTCCCTGTTTCACCGACAAATACAACACTGTGTCGTTGTT
TGGCTGTACAGTTGGTACAAAACGATACCTTCCCCGTTCATCCGTCAAGATGCCTTGGATCGGACTGAGATCCAGGAGCTCCCTCACATCTGCTAACAGA
CTTCTATCCGACGCCACTGACACTTCATCTGGACCTGGAAGAGCCCCCTCCTCCCCATTCTGCACAGCTTGGAACTTGCCTTGTTGGAAGTAAAGCACAC
GGAACGACGAACGTTTCGTGAGTGGCTGCTGCGTGCCAGGACTGATGCACTCCAACTCAATAAAGCCGGCGATGGGGCCCTGGAGGTCTCGAATTGAGGC
TTGAAGCTGTACTCGCTGTCCGGCAGCCAGTGAATCAAGCGTTGTAGAGAAGAGATTTGTCTCTGAGTTGCTCAGACGCACATTGATCTTCGTCTGGCCC
AACATAATCTGCGAACGGTTAACCAGCTCAATGAGTAGAGCTCCAGTGACGTCGTAACCAGAGGATATGTGGAGGTTCTGCAACATCGCCGACTCCATCA
CTTCGTTCATCATGTGCATCACCTGCGCACTCTGCGATAAGCTCTGCCCCACGCGCTCAAAGACCGACTCAAACGACTGCTGTAGGCCACCCGCGTAGTT
CTCTAACATCTGAGCCATCTCGTCCATCGTTGCAATTGGAAAGTGTGCAATTTACAGTTCTAGACATGGCTACACATGGTCAAGTTGCTGTTATTGGAAA
ACATTTCTAGTCAACTGACTCATCCTTCGTTGCAATAAATTACGATTGGGTTCTAATGATGAGGAAATCCAGTTGCCGAGATAGGAACGAGTTGATTAAC
TCAGCGCAGCGACCGTGGTGACTTATCTGCGACCAAATCCACCGCGTCTGCCACCGCCACCGCGACCGCCGGTCATGTTGCTGCCGTTGTCGCGTGTGTA
TGGCGACGGCTCAATGCCGGGCACACCGAGGAGGTTCATCTTCTTGAGGGTCCTTTTCTCAAGCTTCGGTACCTCTTCCAGGCCGATGATACGGCTGTAG
TCGGCTGCAAGCTTGACGAGCTCGACAGGCTTGAGTTTCAAACGTTTCGAGTTCGAGTTGTAAAAACCAAGCCACGCCTGGTACGACTGCTGCGCCGACT
TTTCCACATCATTGTACTTCTTCAAACTCTTCGTAACGTTCAATGTGCGCGACTGGGATGGTTCCAGAATCTCAGGAGAGTAATTTTTGCTCGGCTCCAG
AGGCAAATCACTCAGCTTGTCAAGCAGTGGAGTCTCGAACTCAGATAGAATGAGAACACCCTTGCCCTTCATACCAGCACGAGCCGTACGTCCAAGGCGG
TGAATGTACTGGTCACGATCGGTGAGACCTACCTGCAGCACGAGTGAAACATCCGGATAGTCCACACCGCGAGCCGACACGTCCGACGAGAACATCAGAA
TCTTGTGGCCCTTGCGGAAAGCTTCAGCCGTCTTCGTGCGTACTGCTTGACTCTTACGCGAGTGAATTTCCAGAACACCAGGGAAGCCTGCAGCTTGGAA
GAGCTGCGCCATGAACCCAGCCGAGCGAGCCGTCGGGAAGAACAGCATCACCTTGTACGCCGGCAGCTTCATGTGCTCGTTCAGCACGTGCTCCACCATT
GGGATCACCTCCTCCATCTTGCATACTACGTACTCCTGTTCGGTCTGTACGTTCGTGTCGGCCTCGTTTTCATCAATCGTGTCGACAAACGAGTAATCCT
TACGCAGAGCGACTTGCTTCAGTTCCTCCGTAGAAACAGGTAATGTAGCACTAAAAAGCAGCGTCTGACGCTCCTTGGGGAGGTATCCAATGATGCGCAT
GACGTCGGGGCGGAAACCCATATCTAGCAGTCGGTCGGCTTCGTCCAGAATCAAAACACTAGACTTTCCTAAGCGGTCAGCAATTCTGCCAGTGTTCTGC
TTCAAATGGTCGACAAGACGTCCCGGTGTAGCAACCAGAATATCAATCGGCGCACTGCTAGTGAGCGCACGCTCGTCCTTCTTAATGTTGGCACCACCCA
CAAAGCACGCAATGTTAAGATCCTGGAATTTAGTGAGCCGTTTGGCCTCCGTGGCGATCTGCAGCGCCAGCTCGCGCGTGGGCGAGACGGCCAAAGTGGG
GATGGCGCCGGAGCGTCGTCCCTCTTTGACCATGTTCTCAATCACAGGCAACAAGAAGGCAATCGTCTTGCCGTTGCCAGTCTTGGCTTTAGCCAGCACA
TCTCTTCCCTCGATAATTAACGGGAACGTCTCGTTCTGCACGTTGGTGAGACGCTCGTATTTGAGGTCTTCGACAATGGCGCGCTTCGTGTTGGGCGAAA
TGTCGAGCGATGCAAACAGCACGTCCGACAGGTAGTCCAGATTTGCAGGTTTGGCAGGAGAGGTCTCGTGCTTCACAGTTACAGCAACTGGTGCAGGTTC
TTGGCTGCTGACATTTTCCTTGGCGTTAGCGTTCTTGTTGTTGCGACGACCGCCACGACGAGGTTTCTTCTTCATGTGCTCGGCGTCGCTGTCCTTGCGT
CCTCCAGCGGGCGTCTTGCGGCGCCAGTTGTGGCTGTTGCTACCGTTGCTCTCTTGTCCAGGCATGTTCGGGTCTTCTTGTGGCTTGAATGGGTGCGTAG
CAGCTGGAGAATGCGAAACTGAAGCGACTGTCTCGATCTTCAGAAGTTAAACGCTTTCCACCAACGAAAAGTGCCGCTTCGAAGACGAAAGACACTTGGA
ATTTGTATGCCTCATTTATTCAGTACATGTAAATGTACTGATAATAGATATTACAAAGGAGTACATATCACTCTTTTCCGTCAAGACGATGGTCCAAACA
GCACATATCCAAGCCATTCATACGGTTAATTCGTTCGAACGGCATTTAGGACAAGAAGGAGAAGGATGTCAACGCTCGCGGACTCGTTCCTGGAGGACTT
GGACGAACTCAGTGGAGGCAGCAGCGACGAGGAAGAGACGCCGACGTCCTCCTCCATTACTGGCGTCGCTTCAGGTGGCGACGATGAAGCGCAAGGCGAC
GATGACGACGAGCAAATGCCCGAGAGTCCAAGAGCACAGTCGAGACCAGCCAAGCGCAAACGACCAGAAGATGTCGAGCAGGATCTAGAGCAAAAGACTG
AGGAACTGGCCGAGTCGCTGCGCTCCAGCGTCAAAGAGCGCGGCGTAGCTGCCGTCGCGACGCTCAAGCGCTCACCCAAGTATTTGGGACATGTACAGAG
GATCCAGCAATACGCAGATGTGGACAATGCCTCTACAGCCAAGCCTCAGCCACTGGAAGAAGGCAGTGTTGAGTATGATCTGGTGGTGACGTCCAACGAC
CTAATGGTGCAGATCGACGACGAGATCGAAGCCGTACACCGCTTCATTGCTGAGATCTACGTTTCTAAGTTCCCTGAGCTCGACTCTCTTGTGCCTAATG
CTCTTGACTACGCCCGAGTCGTCAAAGCTATTGGCAACGAGATGGATCTGACACTTGTGGAAGAACTGCCGAAATTGCTGCCTAGCTCAGCAGTTATTGG
AATCTCTGTGACAGGATCAGGTACCAGTGGCAGACCACTCGGTCTTGAAGACTTGAAGACATGTATGGAAGCTTGTGACGAGCTGCTGTCGCTGGATAAG
GACAAGAACATGATTTTGCGCTTTGTTGAGAGCCGCATGAAGTACTTGGCGCCAAACGTGTCGCAACTTGTGGGAACACGAATTGCGGCGCAGCTTATCG
GACTTGCTGGTGGTGTAGCGCAACTTGCACGAATCCCGTCGTGCAACTTGCAAGTCTTGGGACAGGAAAAGAAGGTGTTGAGCGGGTTTTCGTCCACTGC
TGCGCTCAAACACACAGGTGTGCTGTTCTTTAGTGATCTTGTGCAGAATGTGCCGCCGTATTTACGAATGAAGGCATGTCGAGCAGTAGCTGGCAAGTTG
GCGCTAATGGCGCGCGTTGATAGCCAGCCACATCAAAATGACATTGAAGGTCTAGTGGGGGCGCGCTTCCGTACCGAGCTCGTTGCTAAGATGGAAAAGT
GGCAGGAGCCCCAGAAGGCGAAGACGAAGAAGGCTTTACCGATCCCTGACGAAAAACCGCGCCGCAAACGTGGCGGCAAGCGGTATCGCAAGATGAAGGA
GAGACTACAGATGACTGATGTGCGCCGTGAAATGAACCGGCAATCTTTCGCTACAGCTGACGAAGAATATGGTGACAACGCCATGGGAATTACTTCTGGT
CGTCTTGGACAAGAAGGATCGGGAAATTTACGAATTATGCGCAAGGAGCAAAAGCAGTCGAGCAAAAAGCTGCGTGCTGCAAACTTTGCTGCGTCGTCTG
CAAACAAGCCGCCACTTTCTGGGCTGGCCTCAAGTCTTGCCTTCACGCCCGTGCAGGGTATCGAACTCATGAATCCCGAAGCTGCAAAGGCGCGCGTCGC
GGAGGCTAATAAGAAATATTTCTCGGCGGCCAGTGGATTCGTTAGTGTCGTTAAGAAGCCATGAACTTGTCGAAGAGAATTCCGCATTATAGATCCGTTC
TCGAGCAAGGATCATCAAGTATTCAAGTTGAACCTGGTACTTTGTCCACATTATAGATCCGTTCTCGAGCAAGGTTCATACAAGTATTCAAGTTGAACCT
GGTACTTTCCTCCATGTCCTCGATAGGCAGAACTACAGTAGCTAGGTACTGTTTTCATTTATTGAAAACCTACAGTCAAATTGCTCAACTGTCCGTATCC
ATTTCATTGAGTAAACAGCGAGAGCTTGCCGTGCCCAAAGCTGAACTCCAAAGATGTATCGTTCTTCATTTATTGGAGATATGATTTTCTCGAATTTACA
GGGTATAGGTGCACACGTGTTAGCTAAACGTTGTCAAATCTACGCCAATTCGATTATCATTGTTAGCTCAATTTCGCGTAGCCGGCACCGTCGATGGTGA
CCGTGGTCAAATTAGAGAAAAATAAGTCAGCGATATCTTCACGGTCTCCAAAGACATTGGCCAACCAAGAAAATGAGGTTCCCCACCCTCCCACAAATCA
AGAGGTATCAGGGTCGTCACCGAAATCCTACAACCCATTGTTTGCGAGAACTGGTTACCAAACAAGACCCAGAAAAGTGTTCCGGTTGCGATCGACGAGA
CAAAAAGCATTTTTCATAGGTTTCACGCGATCTTGTATGGCGAATTAACTCCCTCCTCCTCACAACGCGAATGTGAAAATAGGAAAGAATTTGAGTACGT
GTTCGAAGAAGTACAATATTTGTCTACCGTAGATGTTTGATACATTGGAAATTAACAGCCTCGGGAAATGTACGGATGCAGTTATTAAATCCCTATGTGG
AAATCAATTTACGATGAACAAGTGCGCTGCACACAAGAAAGATTCAAACATCGATCAGAATATCTGTTGATACATTCACGCACTTTCGCTTTGAAAGTTG
TCAATATTGAACTCAATGTCGTTCAAAATGGCGCGAGCTTCTTGTGGATGGCCAGGTAACAAAGCAATTCTCAGAGTTTGTTGTGTATCTCCTTATTTTT
GCTGCGATCAGAGGAAATACTCTTCATACTTCTGCTCGTAAATAATGCAGAAACGTTTGTCCGGTGTGCGACGGACGCGATGTAGTGTTCCTGGAATCCG
GCCCTCCGTGGCTCTATTCAACGCATGGCCACAGAAGAGCACAATCTCCTTCCCAGGGATGCACACCTTCTCAGCCTTAAGCCACTGTTCTGAATGTGGG
TCATACACATCCAGCCCCTCGACACTAGGTACAGGTTCCACCACGTACAGACTCGGGTCCACGTGCTCAAAGACGTTCTCCGTCTCAGATTGGCCACTTC
CCTCGATGTTCGGGTAGTGCAGGCCATAGCAGACAGAGTAGTCCTTGTCAGAGCGCGCATGGCTCGGTTCAATATCATAGCCGACAGTTAAACTCAGGGC
TCGGTCGCAGATGCGCTGCATACGGCGCTGTAGAGCTAACCAGTGGTTCTTAAACTCTGGTGATGGCCACACCAACCTCGACATGTCCCCGCAAGCCACC
CGGAAACAATCACGCACACTCGTGTGCTCGTATCCAGCGTACCAGAACGGTTTGCCGTGCTCGTTAAGG