Description :
From Genome Similarity Track
Location :
Scaffold_1195:2168- 4504
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1195-snap-gene-0.4Conserved gene of unknown function

Sequence
2336 bases(100 bases per row)
AATCGGCGCAGGTCGAGATCGAGAGCGTGTTCGAAGTGTTTGGCAACCGAAGCGACACGAGCAGCGCGGAAGGTGCTGACGGTGGTCATCGCAATTCAAT
CCAGGTGCGTCCGTCGCTGTCGAACGATGAGCTGGTCACAACGCATGACCTGGTGACCGAACTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NCGGCTACGATGAGCAGCGCCATAGTTTGCCATCGTTCGGTTCCAGTAAGGAGCCCATGCCATCACCGATCCCGATGCGAAAGAGCGGCCCGTCGCCTGT
GGGCTCTTCCAACAGTCTTGGCAATGAGAAGAGTCACAATGACGCCATGGACAACACCGCGTCATCGTCGGCCTCAGTGCCGCATGTTCACAGCTTTACG
TCATCCAACGGTGTCCTTGTGGGGAGCAACGTCGTGAATGCAGACACGAGCCTCGAATCAGCACGGTATCAGCATCTTATGGGCTCTGGACAACTTGGTG
ACGGCGAGGACGACGATGAAGACTCGTCCGAGGAAAACGACGACGATACGGACGACGACAACTTTGTGATGACGGGGACTNNNNNNNNNNNNNNNNNNNN
NCACCAAAGTTGCGTCTGCACGGCACCGAGTTTGGCGAACCGTTTTTCGCGAACCGCGACTTGGACTCCGAGTTGCGTGAAATGAGACGAGCGTCACCTG
GTGAGAGACGTTACACAGTGGGCGTGCGTGACGAGAGCGAGGATCTCAAGAAGCTCATGGAAGGACTGAGCCGTCCGCGTAGCAACTCAATGCCCTTTGG
ATCGAATCAACTTGGTGGGACGCCGACCGCGGACGACNNNNNNNNNNNNNNNNNNNNNNNNNAAAGCCCGCGTGGAGCGACAACATCCCGAACCGCGCAC
AGAGCGCGTACCACATCGAGCAAACGCTGTGCGAAGTGCGCAGCTGTCTGTCGTCGTTCTTGGTCGAGTGTCCCTCGGGGTACGACCGCGAGCGCAAGCT
AAGCTCGATCTTCAAAGTGCTGCGCTCGCTGCACCGCGAGGGTGTGCGCTCCAAGTTCCGCACATTGAATCACGACGACATCCGCTACACCAAAGTGCTT
CGCGAGACGCCGAGCATCATTCGCCTGCTGAAGCTCGCGGGGTACGTGTCGCTGCCGCAGAAACTCACGATGCGCCGCGTGGACCAGGCGTACATTGGCA
TCATCCTGCGCGAGATCCAAGCCGACTTGAAGCACTAAGACTCCTGAGGAAGATGGAAAATGGATGACGGATCCTGAGTCATTATGGAAGCAGCCGAGTC
CGCTTGCTTATCCCTGTTATTTATGAAATTTTAACGAGAGAAACGACGATGAAGGAAGAAAAAGAAAAGAGGAGTTGTCAAGTACAGTAAGTAATGAAGC
AATATAGCAATAAAGGAAGCTGCAAGTGGGCTTCGACGGCATGAGAGTAGCTCATGCACTCAATCGAATATAGAGTAGTAAGTTTTCTCTTTTAGAAGTA
AGGACAAGTTAGAGTTGACCGGATAGAGTTAAAGTAGTACAGATACAACAACGATCACACTGCATTCATAAAGTAGCAAGTAAATACAAAAATAATTGGG
AGAATAAAAGACTTGGCTCGTGCTGTGCCATAGTCCCTAACCGTCCCCAAGTTAGGGACAGTTGCCTTTTTTGGTTTGGGACAAGGTCATAACTTGGCAT
CTCCGAATGAATCCGTTCTCGAAGGCAAGGATTCGTTTCTGTGGTTCAAACCGAGCCTAGCGAGCATGGAGCCGCAGTTGCAACCGACACTGCGGAACTC
TGTCTGGTTTGCCGGCACGTTATCGTCATCATTAAGAGCATCATCTAGAGAACCAACCACGACGAAGTGGGATTATGGGCCGAGGTGCCACATACGTCTA
CGTCCATACGAGCTTGCTCATATGGAAGGACGAGCGCTTTACTCCGTTCCTCACGCGGAAGTTTAAAAGGGGACTGAAACAGATGCAGAGACTGTATCCA
AGAATGAAGAATATGTGTCTGTCAAAGTGAAAAAAGGAAGTCATGACTGCTAACGGATCCTCATCCACCTCTTCTTGAGATTGCGACTGAGCAACTGAGT
GATGCGAATGATACGCTCGATCGTGTATTGCAATGCCAACCCACGCCGGATGTATGGTGGTGCAGCTTAGTGGACCACGAGTTTGCCATGTTTAAGATTC
CAGCCCGCCACAAGATGATCTGCTGCTTGTGAAGTG