Description :
From Genome Similarity Track
Location :
Scaffold_1995:2168- 3337
Sequence
1169 bases(100 bases per row)
GTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACCTCTCAGCATCCGACGCTTGATCTCTCATGA
GGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGGTCCGATATGGCTGAGATCCGTACCCT
CTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGG
AAGTTGTCTGCCTCCACTGACTCCATTTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGTCA
GGAAACGACTCATCGCAGCTTCGAAGTGCCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGCGGCCGTCTGGTCCACTGGCGAGACAGGGTCCGT
GAGGTGATTACCTCGAGCCTGATCTGACGATAATCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGATGGATTGTGTCAGATCACGCGTAGGTCCT
ACTGGATCCCGAGCCTTCACGTTCACAGGGGCTTCCTGTCTTCGGACCCTCGCCCGCGCTTCCAGCATGGATGCCCCAGAGGGTCCTAAAGTCATGCGTC
GTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGGTCCATAGTGCG
CGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGAATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAAC
ACACCAGCTACGATGCCTGACTCCGTAAGCAGACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCCCACCGGTTCCCTTG
GATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCCTGGTGGCGATACACAAACTCGAGATCCTTGTC
GGACCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTT