Description :
From Genome Similarity Track
Location :
Scaffold_327:21678- 25532
Transcript NameFunction/comments
Phyta_totarag7159hypothetical protein

Sequence
3854 bases(100 bases per row)
TATACTCCAAGTTCATCACCATTCTTTGCCACGACCTGGCGGGTTGGGAGTACGAGGATACGATTCTGGACCACACCGAAGCCGGTAGCTCCCGTTCAAA
GCGCTGCTGAGATGATCTACACCTGTAAATTTGGTCGTTTGGACGACAAGTTCTAAACAGTAGCGACACTACATTTGATGCTCTTTGTACTCCCTTCAAA
AGCTTCTTCGTTCATCGTGTTATGGTCATTTTCCTGTTGCCTATGAGCCGCAGCCAGAGCACGGGGCAAGATGGGCGAGTGGCAGGCCTagcagcttcca
gcttcCGTCTTCCATCTTCGCCACggtcttcgtcttcaactcgGCGGTGGAGTGGCGGCTTACTGATACAGCATACTGTCGTGTCACTTGCTTCTCGCCT
TCACGTCCACTCCTCCACGTAGGCTATTGATTGCGCTCGATTGCcgctcgccatcgccgcTGTCGTGggctcttcatcgtccttGTTCTTTGCTTTGATA
CAAGTCCTAAACATGCATTTCTCCTCTTTTTGTATCTGTCTTATCTACAAACGCGCAAAACTTTTGGTTCCTTTCCTGCTTCTTGTCACTAGCTTGCTTC
CTCCCCCTGTCATCATCATACCCacgcgtcctcctcgctggTTGCTGCGCGTCTCCAGCGTTACCGGGTCCTCCtcgcttctccgtcgttCATACACCAC
ACGCTCTTCCCTAACTGCTGGTTCATACTTTTCATCCCACCACCGGTCGGCTGggctctctctctctttaTGCACGACTCGTAGCATTCATGTCCATGCC
TCCCACATCATTCAACATCATCATGCTGCCGTCATTACCATGCATCTGCGGCATGCGGTTGCCgcggcctcctccttggaaGTGATGAGAGGCGCCGCCC
ATGTGACCGCCCTGCATTCCGTACATCTGGTTCGgttgcaggtgctgctgttgcatgTAGCCTCCCAtagacgaagacggcaaaTGGCCCATCATCATAC
CATTGGCGCCATTATCGAACAGATTGTCGGCAGTCGGCGACATGCCCATATCCATGCTGATGTCCATGTTCGGGAAGCGCTTAAGAATACGCGCGGTGAT
TCGACGACCGCCCGACGTGTTCTTCATAGCTGCCAGGTGCGGGCGGATCGCCTTAACCAGTAGCAGGCACTGCTCCTCAGCACAGACGCACAGCGCACGC
TGCACCACGTAGTTGGCGAACTGAtcctgcagcatcttgttCATCTTCGGACAACTCGTGATCTCAGCGATGTACTTTTGGCGCACACGCTCGGGAGCCT
TCTCCAGGCACTTCTCAATCACATTCGAACTAAACTTCTGCACCGAAAGCTCGTAGATGTGGCCCAACGGCTTCATAATGACACCGAAAGCCTCCTCAGC
CGTACAAGAGTCAAGCACGTACTGCACAACATAGTTGCCATAGGGGTCctgcatcagcttcatcgccTGGCGCTCCACCTGCTCAATCACCTCCGCCTTT
TGCGTCTTATTTGCTGCGTCCAAGCAACGTTGCAGAACGCAGCATCCGTGGCGATGCGTTCCAACAGTCGTGCATTCCTTACACACAGCATCGAATACAA
ACTGGTTGTACTCCGGCTTCATAAACTGCAGAGCACGCTGGATCACGTGGTTGCCGTTTGAGTCAATACACAGGCGCACGGCATcgtccttgagcgcctc
AACAATAATATCCGGCAGACTCGTCGTTCGGCGTCGCTCACTACCTTCAGGACGCTCCTCGTGATCGTTCACATAGCCATagtcatctccatcttcctcg
tcataGTCTTCCTCAATAATGTCAGATGATGTTGCACAcacttccaccaccttctgcacCGACCTCGTACCGTGCAGGTTaagtgcagcagccacaagaT
TCGAGCTCACACGGCGGATAATCACCAGTCGTTGCTTCTCGTTCAcacgttccagcagcttctggaagagGTAGTTACCGAATGGGTCAACCATCATCTC
AGCAAGGTGCTCCAGCGATTCTTGGTAAATCACCTCACACAGGTCGGAACGGTCTTCGTAGTCGAgttgctcctgcagcagccgacagCCATTCTGGTCC
TTCGACATAGCGAACACGCGGTTTTGAATGTCCTCCACGCTCAGCGCAGCGCTCAAACCCGACGGGTCGTTCGCAGAGCCACCCATTATCGGTGCGCTCA
TGCCACCACCGTTCATTAATCCCATACCTATACCACTGACACCAGAATTCTCCGAGCGGTAACCCATCCGAGACTGCTGACGTCCTCCAAACGGTCCATT
CagctggtggccaagatcgtCACCGCTCATttgatggcgctgctgcggcatcATGtgagacggaggaggcgacATCATCATCCGGCTCTGTTGGTACATC
ATCGAACCGTTCTGACGGTTTGAGTTGTGACCGCCGCCCATGTGCTCCGGAGTCGGAGCGCCAGTCTGGTGCACAAACTTGCACTTACTGCCCATACGAC
AATGGCCTTGCAGGAAAAACTTGCACTGCTTCATTCCCATCTGCATGCCTCCTCCCATTCCCATTCCCATGCCCTTGCGAGGCGAGTGCGGGGGAGACGC
CTCAGGGAGCGGCGGTGTCATGCGCGAATACATGTTGCGTCCCTGCGCACGACTATTCGAGTGACCTCCACCACGCATTCCCATGGagccctgctgctgc
gaacCGTATCCCATCTGCGTATGAGGGTGCCTCATTGGACTCGAGCGCGGGTTCATGTACATGGTGTTTCCACCAATGTCATACATGCCGGCAGGCGGGT
GCGGTCCCACAACCATCGGGTTCCATTGACCTGAAGACATTTGCGCCCGGGACGTAGTTCCACCATAACCGTAGGATCCGTTAGCAGTCTGCGGCGACCG
gtactgctgttgttgctgctggtgatgacgatactgctgctgttcataTGAAGCTGCCATTTGGTTGTTGCCATAGTAGTCTTGCATCTGCTCCTGATAC
AAGGCGTTGTTGTCACCGTCTTGGCTGCCTGACCAGGAATCTTCCGATGACACCCGCGGACTCAGCGCGTAAGCTCCGCTGTAAGCAGCGCTGGGGGCAC
TACTAGTACCTGGCACCGTGCTTGAACGCGAGAGAGAAAGCGACGTTGGCAtatgctgttgctgcgtgtCACGGCCACCGGACCGATagcgctcctgctg
ctgttgttgctgagcGGCAGGTGACGgttgctggtgtcgataACGACCACCCATTGAAGCATACTCATTGGGCGACTCTTGCACCGGATTGAGCTGGAAC
TGACCAGACACATACGCGTTGGCACTTCTAGTAGTAGTCGGTCCGCTGCCCGAAACACCATTGCCACCGTTAGCAGCACGCTCGTTCGTCTGGAGACTCA
TCTGTCGGTCATCCAGACTGAGCTTCAGGAAATCTCCACCCAGCGCTTGGCTTGGCGACTGCGAGAGGAACATCTCAATGCTGTTTTTGCGCCGACTGTT
GTGTGATGGCAGCATCTCCATTTGCGGCCGGATTTTGCGGACCTTGATATCGATCGGTCTCCCCGCATCGCTGCTCGATACGTTCGTTGTGTCAGCGACA
GCGCTCGTTTCTTCCCGCTCGTGACTCGCTTGGTTCGATGGCGAGATGGAACGAGGCGGCAACACGTCGTTGTTGCCGgcgacatcagcagcattgttgt
tgttgccagcAAGGTCGTTACTGGGCTTCTTGTCGCCGCTCTCCGTGGGTGCCGAAGACCCGTCCTCGCTGTACTTCATGGGAGCGAAGAAGTCGCTCGA
GCTCCCGAAGCGGAAGAGGTTCGACGACTCGAAGCTGAGGCTCGGAGGAGCCGA