Description :
From Genome Similarity Track
Location :
Scaffold_522:21677- 24281
Transcript NameFunction/comments
Phyta_totarag9004hypothetical protein

Sequence
2604 bases(100 bases per row)
CATTGAGCATTTTGTCTTGCTCCCCACACTCCTCGATCCGAAGTTAACTTCAATCGCATGGCAACTTCAGCGGACAAAGATGAATCGAGTGAGGCGCAGT
ACGCACAACTCGTCAGtctacgagctgctgccagcaactCCAACGAACGTGCTGTTCTCATCAATGACACGACTAGTgacatcgacaagaagactGCAAG
CTTGAACGCTAACCAGCAAAGACCCCCCAGCAAGTTTTCATTTCTCGATCTCTACCGTTTCGCGACTCCGTGGGATCGAGTGCTAACGGTGATCGCCGTA
GTGGTGGCCGCAGTAAACGGGGCCCTCTTCCCATGCATCGCACTGGTATTCGGCAAAGCCATCGGCGCCTTTGCCCAAGTCGACGGTGGAGTCGACCGGG
ACACGCTAAACAGTGCGGCACTTGACTATTTTCTCATAGCGATTGGGCTTTTCGTGACGTACTATTTGGCGTATTTGCTGTTTTCATTGTCGGCTGAGCG
TCAGATGAAAGCGCTACGTGCTCAAGCGTTGAAGCACATGCTCTATATGGACATTTCATGGTATGATCTTCACGACCCACTTCAGTTATCTAGTCGTATT
ACTGGCGACACTGTCAAGATTAAGGATGGGATGGGTGAGAAACTGGGAGACGGCGTCAAGTACGTGTGCCAGTTTATCTCATCGGACTAGCGCGTGGGTG
GGCCATCGCGTTAGTGACGACTTGCGTTATTCCTGTTATGGGCTGGTCGATGGGGTTCGTGATAAAGAGGTGGCAGACGCGGGCAACTTATGCCCAACAA
GTGTACGCAGAGGCAGGAGCTGTAGCTGAGGGGACACTGGGCTTCATTCGACCTGTTAGTACACTGACTGCACAGCAACGCgcgctgaagaagtacaaca
AGCACACTACGGAGGTCGAGAAGGGTAACATCGAGCAGAGCAGAATGCTGGCATTGATGATTGGTCTTTCTCGCAGCTGTGACTGGCTCATGTACGCTGC
TGGATTATGGTACGGAGGTTCGAAAGTCTGCAGAGGTGAGGCCTCGCCAAAATCTGTCTTCCAGTCGCTGATGGGAATTCTCATGGGCATGCGGTCGATC
GGCCTCATCTTCCCCAATCTCACAGCTATCCTCGAAGCGAAGGGAGCCGCCGTGGCATTGTACGAGCTCCTAGACACTCCGTCTCAAAACGATGCGTCTC
AACACGACGAAGGTATTATTCCAGATACATGCTCCGGTCGGATTGAAGTGGTTAATGTCAACTTTGCTTACCCAAGTCGACCATATGCTCCGATTCTAAG
GGATTACCCGGTCATAATCGAGAGCGGACAGACTGTTGCCTTCGTGGGAGCTAGCGGGGGCGGCAAAAGTACTATTATTTCACTATTGGAGAGATGTTAT
GACGTCACTAGTGGCTCAATTCTGCTCGACGGCCGTGACTTGAGAACACTAAACGTCAATTGGCTACGTTCCCAGATTGGATTGGTTTCGCAGGAGCCTG
TGCTGTTTGCCACCACGATCGGGGAAAGTATTGCTGCAGGTCGAGCTGATTTAACTCGCGATGATGTTATTGCTGCCGCCAAGACGGCCAACGCTCACAC
GTTCATCATGTCGATACCAGAAAATTACGATACTCTGGTCGGCGAGAAAGGTGTTTCGTTGTCTGGAGGGCAGAAACAGCGTGTTGCAATCGCTCGAGCA
ATCATTCGGGAGCCAAAGattttggtgctggacgaggccacaAGTGCGCTGGATGCTGAGAGCGAACAAGTGGTGCAGGACGCCCTGAACGACTTGATGG
CGAAGATAAACATGACAACGCTGGTGATTGCTCACCGACTGAGCACAATTCGCCATGCTGATAAAATCGTGGTACTAGCTGACGGCCAcgttgtcgaaga
aggtCCTCACGACGAACTGGTGGAGCTTGAGCACGGAGTCTACCGCAAGCTGTATACAATCCTGGAAACGAAATCGAAAGAagaggctgaagctgctgca
ttagCTTTGACTGAGGCAGAAGTCTCACGAGACCAGGAACatgacgaggatgacggTGTTTTAGCTCGGAAAGCAAGCTATCGCCCCATAAGAAGTGGTC
GTACGCGTAAATGCGCTAGCACTAACAGCGAGACTGACGCCGTGGCCGAATCTCCACGTTGCAGGACGCCAATGAGCTCAGCAAGCCAGAACGCGCATAC
TTCGTCATGGGAACGGTCGGAGCAGCAATAAACGGTGCTTCGTTTCCAGCGTCGGCAGTATTCATTTGTCAGCTGATATCGATCATGACTGTGGACTACG
CCTACTATCAAGAGTACGACGATTGGTCGTATCTACCACCGTTACCACACAGAGTGACGCTGTACGGGTGTCTGTATattgctggagcagtggtTCTTTT
GATCGGCAGAGCTCGCCAGAGCTACGGATTCCAGTATATGGCGGAAAAATTGACCGCGCGCCTTCGTGGAATCCATTTTTCGTCACTATGCAGACAGAAC
ACTGCGTTTTTCGACAAAACTAAGAACGCGACTGGAGCACTTACGACTGACTTGGCAACGAATGCTCTTCGTGTTGCGGTCATCTCTGGTGAGACACATG
GCCG