Description :
From Genome Similarity Track
Location :
Scaffold_111:21676- 26879
Sequence
5203 bases(100 bases per row)
AATCCCCAAACGCCTCTCTAAGTCGTCAGCCGTTACTCCAACCGTAACTTCAACCATTTCGGGCAGCAACGCCTTTTTCTAACATTGCTCCAAGCGTTGG
CTGCCACAGCGCTTCTGGCGTCCGCTGACGGTTCGACTGGCTCAAGTATGGTAAAAGGCAGTTCTGTGGCAAAGAGTGAAGGAGTCATTGAGAGCCAGCA
AGACGCTCGAAGCTCGAACCGCTTGAAAAGTGTCGACGATGCCGAGGACGATGCCGACGAGAGGATTCTGGGTGCCTGAGTGTAGAAAGCCGTCATTTCC
GCAAAGCATGTCGAAGCTCATCGAGCCTATAAAACTGCAAATCGAGTCTTCGCTAGCTGGGACGAGAAATGTTGAAAAAAATAAAGAAACTGGGGGTCTG
CAAAAAATCTGAAAAGCCCTGAGAAAATGGAATGTATGATACAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTAGTGCTCTGAATACAG
TCCTCCCTGTGCGAACTTTAGTTTGGTGGGAATAGCTTGTAATAAGTTTCAGTGGTTATTAGGTATTGGATCATGGTGGCGTCGTACACATACTGTAATA
AAGTCAATAATTACAGACAAAAACAGGGGAAATAAAAAACGGCTCAGATAGTTGGAAAATAAAAAATGGGAAACGTTAACTGTAACGGGGCACTGATCGC
TAGTATTGATTCAGTACTAGCTCTCCTACACTGACAACAGTGTAGGCGGGTGCCCCGTGACTTCACGTACACGGTACGCAGAGGAAGAGGAAGAGTAGTC
TTTCTAAGGAAACGAACTCTGAGATATAGGAAAAGATAAACTGTATTTAATATAATGGTCCTAATTCTTCTGTCTAATTCTTCGTACTAACTTCATTATA
TTAATCTACATCTACGTATGGTAACGTCTTGCACATCACCCATTGCGCGCGTCTAGCAGCGACTGGTGGGGTTGATATAAGTGGTCGATATCAACCAATG
AGCAGACCCTTGAGTCACTCCAACAATACACTGTGGTAAGTAATATTGTATAATATTATCTCTTAAAGTAATATTGCTTTATTGTTATTTATTATTAATC
ACAATATTATGTAACAGGCTCACCCCGTTAAATCACCTCCCCCTTAAACGATAGTCACGATAGTGACTATTCTATTGGTAAGTTTCCCCGTTGGAACTAA
TTGGGAAAGGGAAGCACTTGTTGGTCAGTTCTTTCCATTTTCTGACCATCATCGCATGGTTAACAAGTCCATGCGGTGCGCAGCGCAAGCTGCACAGAAA
GAGGCTACACGAATGAGTGTAGCTGCATGTGATAGCGCACTGCTACCGTCGTCTGCTGTAACATCTTCTCACTCTGCAGCACCTGTTGCATCAGGTGCAC
GTGGTACCTCACCACATGCTAATGATGTCTCCCCTTTGGAGCTCATCTACTATGGTGAGCCGGGCGATGAGTCCGACTCAAAGAAGTCTGTGAGATCGCC
CGGATCACCCTGGGCGACTCAGTCAGAGCCTTCGAAAAGAAGACTCACCCACACTACGAGAGAAGTGAGTTTCTATCACTCCCCCTTTGGTTCTGATGGT
GATGAGCCTGATGGTTCATCACCTACGTCGAGTCATACGCACTCACAAGTGCGCGATGTCAACGATTACGACGATGGCGCGAACCATCGTCATTCCAGTG
ATACCAACTACCTCTGTTAATATAATTCAGAAGGCTCTTGATCGCAAAACGTTGCGTCATGCCCCTGATCACAAGCCTTGGCGACTGCCAGAGCTTGTTA
TTAACAGCTTGTCTGGTGAGACAAGTGAACATCATCAAATACCCTTATTTGATGCTTCCAGGTTTCACTGTCCTTCAGCACAGCGATAAAGCTTTTATTG
CTGAGAGGACTTCTACCTCGATGTTTTCCTTAGACATTAGTAACCACAAAGCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNN