Description :
From Genome Similarity Track
Location :
Scaffold_1860:2167- 4141
Transcript NameFunction/comments
Phypl_g14280hypothetical protein PHYSODRAFT_515521

Sequence
1974 bases(100 bases per row)
AAGCCGCACTATTTTGCCATGTacaggtacatgtagacgAATGACAGGCCCGACGCCTTTGGATCCGGACGgggacgacagcagcgcgagcggcgtcgcc
gccgccgcggtTTAACGACCGCATCGGAGGGCATGTTACTTTTTGCTGGTCTACGTCTTGAAGCGGCGAACGTAGAACCGCTTCTGGGCGTGCTCTGCCG
GTGCATGCCGGTCGCACTGCACTGCACCGTGCAGTGCGACAGCGGCAATGACGGGTGTAGACGGACGAAGGCGCGCGCGTGGTCTTTCAACCATTTGCGC
AAACAAaggaaaatgctgctggctgttgcGCCCGCTCTCCAGTCAAAGCACCGGCACGTGTGTCTGTCCGTGCACGGCAAGGCTCATTGTCCATTTTTCC
GGCTGACCGACAACCGCGAtggcagctccttcttcctctgcggCGCGCTCCGCCCTCTTCACGCTCGAAGATGTGAAGATCGCGTTCAACATCTTTTGCT
GCATCTGCGGTATCGGATCGCTCGGCATGCCGTCCAACTACGCCCGCGCCGGCTGGGGCTACGCGACCGTCGCCCTGCTGTTCATGGCGTTCTCCAACAT
CTACGCCACGGTTCTGCTGTCCAAGGTGCTGATGGTCGCCCCCGCCTCAGTGAAGACGTACAGTGACCTCGGCGAGTGGGTCGCCGGCAAGTGGGGCCGC
TTCTTCGTGGTGGTCTCTCACATGGGCGTGTGTTTGCTCGCCCCGTGCGCGTTTCTCGTGCTTGGCGGTACCctgctcgacgtgctgttccCCGACTCGT
TCAGCCAGACCGTGTGGATCATCTTCATGGCCGCGCTGGTCATCCCTGTGGCTCTGATTccgacgctgaaggagagTGCCAGCATGGCTGTGGCTGGATG
CCTCGGCACGATCGTCGCTGATGTCATTGGAGTTGCGATTCTCCTATACGAGGAGCGCGGCCATCCGACCCTGCCGACGCCCGATGTGACATTCCACCAG
GTGCTCACCACGTTCGGCAACCTGTCGCTCGCGTATGCCGCCGCTATTGTTATCCCcgacctccagcgccagcactcGCAGCCCGAGCGCATGCCccgcg
tcatcgtcgtcagcCTGGGTCTTGCCTCAGCTTTCTTCCTCGCCATTGCCATCATCGGCTACGTTGCCGGCGGATGCCAGCTCTCGGGCAACCTGCTATT
TTCGATCGTGAACACATCCGACCCAtacagcaccacgacgctgggGTTCACAGCCAACCGCGGCGCGGTGGTGATGTCGTACCTGTTCATGCAGCTTCAC
CTGTCGATCGCCTTCTCGACAATCTTGCACCCGGCGTTCTACATGGCGGAGCGTCTCGTGCTGGGAATGCACAAGGGCGAACCCCTGTCCACCGAGGAGC
GTGAGATTGAGATCGATGAAAAGATGTCGTACCTCGCTGCGTCGTCACCTGCACCGGTCGTCCCTGACCTCGAGAGCAACACTCAAGCCGTTCCGGGCCG
TTCCTCGACGCGTGTGTCGGCTACGAAATGCCAGGACGATCTCTCTGAGTACAAGGGCGGCGTGAACGTGATTCGCTACGTTCTGGTGCGTATCGCTTTG
ATTGCGATTCTGGCCGTGGCCTCTATCCTGCTGAAGGACCACTTCCTCGACCTGGTGGACTTCACCGGCGCCACTGCCATCACTGTGTGCAGTTTGATCC
TGCCGCTGGTATTCTATGTGAAGGTGTTCTGGAGGAAGATCCCGCTGTGGGAGAAGGCCGTCTGCATTACGATCGCCACCGTCTGTGGTTGCGTCGGCTG
CTACGTGATGATCTACGCTGGCAAGAACTTGTTCAACccagacgacgacagcgccacgttcCCGTACTGCTCAGCCGAGTACCAGGACGAGCCGTACTAC
GTAAGGAATAGCACGGCGTCGAACTGATCAGAGCAGCCAGCAGAATGCCTTAGCTCTAGCTAGAATGCATTAGT