Description :
From Genome Similarity Track
Location :
Scaffold_1184:2167- 4103
Sequence
1936 bases(100 bases per row)
CGTGAAGGGGACCGCGGCTGAAGAGATCAGGTACGTGGTAGCTGATCCGTTACAAAACGGCCCAGCCGTCAGCCAGACGCGATCACGATCGAAGATGGTG
AGTTGCAAGAACAGGCCGATTGACTGGTAGAAAATTCGAAGCGGCAAAGACCGACACACCTGAAGAAGAGGAAAAGGCAGTGAGATCTCCAGCGGTGATC
GATACGATCGAATCCATGAAGAGGATGATCGAGTTAAAAAACCGACCGACACAGACGGTATGCGAGTCGAGCGGAATCAAGGACCACGAGTGCAATGGAG
CTGATCCAGTCTACAATCAGTCCAGCCATCAGTCAGACAGGATTAAGAACGAAGATTGTGGGTTACAAGAACGGGTCTTCACCTCCACGTCAATCTTGGT
ATTATTCATTTTTTCGCCGATCGACGGGCGAAAAAAATGAATAATACCAAGATTGACGAGGAGGTGAAAAAAGGAGATGTATCGTATTCAACATTGTATA
ATTCGATGGCGGTAAGCTTCGCTGAAGATGTCAATCAGCCTTTGGCAGTTCTTTTGGAAAGTGGTATACCCACGCATGAAATAATAATTGATGAAATCCA
AGTGGGCGAACCAGGTGTCCCAAGGACTGATGATCAAGAGAAGTTGCGATAAGTGATTTGGAGGAGTCGCCATTTGCTGATTGGAAAAGGTAATGAATGC
TCTACCACCTGCGGCGAGTGGGGCAGTTTTTGATATATATGTGGGTGGGGCCAACCCGGTCACGCAGAGGGTCAGGCCTGTGGCTCCCAAATTTCGAGAG
AAACTCGCCGATCTGATTAAAGAATTACTGTCGACAAGATCATTCGACCATCTACAGCACCATGGGCATCTCCTATAGTGGTGACCATCAAGAAAACAGA
GAAGACATAAGGTCGTACTTTGATTGCAGGATGTTGAATCCCGCTGACTATGTTGATGGTATACCCTATGCCTCTAATCAGTGAACTATTGCAGGACATG
GATAAAGCCATGTGGTACCGGTCTCTGGACATGGCGAGTAGTTTTCGGGTGGTGAAAATGATTGAAAGGGCAAGGGCGACTTCCACTTTTATCACACCAT
CATTTTGTTTTTGAGTGGTTACAGATGCCTTTCGGGTTGAAAAACGCTCCACAGATTTACCAACGATTGATTGATAACGCTCTCTATGGATATTTGAAAA
TCGGCGCAAGATCCGAATCGATCACGGCCAAATCGATGTCATCAGCGATGGTGAACCCGATACTTATTCGAAACCATCAGTGTTGTGTCGAAGATCCTAT
GTCGACGACATGTTAATACGAGCTACGTCGTAAAAATGCCTGAGTGAGAAAGTGAAGAGATTATTGAAGGTGTACGATAAGTAGAACTTGTCGATCAGTT
TGTCCAAAAGTTTCTGTGGACGTCGGAAGGTGGAATGCCAAGGACATCAAATCTCGCTTGCAGATTTGGAAGCTAAGGCGAAAGATTTGGGATCTTTGGT
GAGCAACCCGTTTCCTCGGGCGCTGCTATCGATACAGTCATTTTTGGAAGTCTCAACTATTACAGTCGATTTATTGAAGATTTTGCGATTTACGCCTCAG
TGTTGTACGAGCTGCGTGAAGCAGATTTCTATGAGATCAGCCGCGTTAGTAAAGCCCTAAACAGTATATTTGGGAAGAGGCGTGATTATGTTCACGTAGG
ACGAGCAGGGCACAAATGGGATATACCCCCTAAAAGGGAGATAGAAGCAGATCGGTGCCCAAAAAAAGGGGTCGATAGAGATTCGTACCCAAAATCAAAG
AAAGATGTCACCCAACACGGAATAACAGGGGACGATCGAGATTCCGAAGGCAGAAACCGTTGGGAGAAAGCAATGATAACATTCCCGTTGGTACAGGAGA
CGATCAGTTCAACACCAATTTTCAAACAGTTGGATC