Description :
From Genome Similarity Track
Location :
Scaffold_51:216687- 218697
Transcript NameFunction/comments
Phypa_INRA-310PPTG_15714arabinan endo-1,5-alpha-L-arabinosidase A

Sequence
2010 bases(100 bases per row)
GCTCGAAGATTAGTCAGTGATGGCAAGTACTGAAATAGCGAATGCTCCAGCTTCTTAGTGTAGTAGATCTGGTGGGGGAACGCCAGAGGTGGAAGTGTGC
TTTGAATGGCTAGACGCTGACCAATATTCCAATAGTGTTGACGTCTAAAATACTTGTGTTCATTGTGAGAAGGAATGTCCATTTATAATGCCAGTTATTT
TGCCAATATCCTTAGATCAATACTTACCTGTGTGGCATATGCTAAAACTCGACAAATCATCCCCAAATTACCATGCGAGCGAACACATTGTTGTGCAGAC
ATGCTCCAAACCGTTATATTTGTGGTGGTCACTTTGACCGTGCGTCAGATACAGTGGGGATTCGCGAACAGGTCGATGCCTTGGCCTGGAGAGCTTTGAC
ACGCTCATACTCCACGCGTGCCTCTATTAACGGTGATCCTGGAATCCATTTGGTCGCTGTTCACGTTTCGGGATAATGGTGCCAAGATTTGCGGAGTTAT
TCGACTAATTTTTTTGTAATAAATCTGGAACTTAGTGCAAATGACAAAGTTAATTGCTCTGCAGCCAAACTTTCCATCTCATTCATTCATTGTCATATTA
ACTCCTGTACACAACCAAAGTCTCCCAGTCCAGCCATTCCAGTATATCGAACTGGTAGCGGACCTGTCGGGTTATGATGACCAGCTCTTGTGGTTTGATT
AGTCCGCAAGCTGTAGAGCTCAAGCAAATCCACTGCAACAGTCGGAACTACGGATCCAGCTGGTAGATAAACGGTTTTTGAGTGTGCCAGCCTGGCACTG
TCAGGGTGTTCGAGTCATGCAAACCACGTGACAGCAGAGGCACCACCCGATGGTCCGCTATGCTGTTCGAACGTCATGACCGGCTCACAGTCAATTTGGC
ATTTTCCCATTTGACGTCTTCCTGTTGCATCATGAAGCTTCTTTCGATCCTCGTTGGACTCCCTCTCCTCGTGGCTGGCGCCGTCAACGGATATGCCAAC
CCCCTAACATGCACGGGTGTCTGCACCAACGCACACGACCCATCCATCATTCGTCGCGATGATGGAACGTATTTCCGCTTCTCCACTGGCAACAAGATTG
CTATCCACTCTGCTCCTGACCTCACAGGTCCTTGGAAATACCTGGGCGCTGCGGTCCCCGGTGGCTCCAAGATCAACCTGAAGGGCAAAGATGATCTCTG
GGTGAGTATCTCTCGACAGATTGAGGACTTAACCAGCTCGAATTAACCTAGTAAACTGTTCTTTGATTCTAGGCCCCCGATGTCCACAAGGTCGGGGACA
TGTACTATCTGTACTACTCGGTGAGCTCGTTCGGTACGCAGAACTCTGCTATCGGTCTTACCCGCTCCAAGACAATGGAGGCAGGCACTTGGACGGATGC
CGGTAGTGTCGGCATCACGAGTGACTCGTCCAAGAAGTACAACGCCATCGACCCGAACCTGGTCCAAGTCGGTAGCCAGTACTACCTCAACTTCGGCAGC
TACTGGCAGGGACTTTACCAGGCAAAGATGAAGCCCAACCCAACGAAAAACACTGGCGAGGTCGCGAGCCAAGTGGCGTTTACCTCGAACTACGAGGTGT
TGGAGGCTGCGTTCCAGTTCGCCTACAAGGGCTACTACTACATGTTCTTCTCCAAGGGATCGTGCTGCGGCTACGACAAGACCCGCCCGGCTAAGGGCAA
GGAGTACCGTATCCTCGCGTGTCGCTCGAAGAGCCCGACTGGAGGCTTTGTCGACAAGAACGGAGTCGACTGTCGTAACAACGGTGGCACGATCGTCTTG
GAGTCTCACGACTGGGTGTACGGTCCGGGAGGCCAGGGTGTCTACAACGACCCGAAGTACGGCCCCGTGCTGTATTACCACTACGGTAAGCTGCTTCTCT
TTAGGATTTTTCCTCCTGTTTCTACTCGATCTGACGTTTGATTGTAATAATTCGTAGTGGACACCCGTGTTGGTTACGCGGATGGTGATAAGCGCTTTGG
CTGGAACAAG