Description :
From Genome Similarity Track
Location :
Scaffold_1:2166382- 2170544
Transcript NameFunction/comments
Physo_468899PREDICTED: uncharacterized protein LOC101767957 isoform X1
Physo_555458predicted protein
Physo_285717putative ribosomal protein large subunit

Sequence
4162 bases(100 bases per row)
GTTGTGGAGGAAGAATTGTGTCGTCCCGCTGTAAGGTTGCTGTTGTCGGCCAAGGGAGAAATTTGAATGTGTACGTATCGCGGAAGTGCTCGATCGACAT
ACGCTTGGCGTCATAAAAGTCTTCGATTCGTCGGCAATCCTTTGAAGCAGCGCAAATTGCGTGGACACAAGGGAACATTTGGTCTTGCCAATAGCCGCAC
GTGCACTCCTGCGCTGGCAAATCCACTACCCGGTCTGGGTGCACATATCCTGGTATGGCAACAGGGCCCTTGAACAAGACGCTGTACGCACCCCCGAGAA
AGGGTGTAAACTCGCACATATCAGCTGCAGCTTGGCGGTCTGTATGTCGCTCTAACAACTTGGGGACTAAATCCGAGAGTGCGCCAGATTTTGTCCACGT
TACAATCAATTGTCGCCTTTTGGACATCAGTTGACTCAGCTTCAAGAAGTACAAGTGGAATCCGTCCAAGGGTTTGGCGGTCCGAAGCTCTTTACCCATC
CAGTTGTTCGCTTGCTCTGACAAATTTGAGGTTATTTCGTCGAAAGTCGGGAGATTAAACTTTTCTTGGAAACTGTACTTCACCCAGTGAGCAGTTCGAT
TCTGTCCAGAAAATTCGCAGCGGCAGGGTTGTTCACGGCGAGTTCACTTCGATACAGCTTATAGTCATTTTCACAGTCGCTGCGTGCCATTCGGCATACC
CACGCACGATCTTCCTGGGACAACCTGAAACATTTCCTGTTAATGTTGTCCATGATATGCCGCAGGCAGTATCGATGGCCAGCGTTTGGGAAAATTGTCG
CGACAGCTGGAAGCAGACCTTTTTGTCTATCCGACAATATCGTGAACTTTTCCCAGTCAACTGCCTCCTTGAATGCTCCCAGGAACCAAATCCAATTGGC
CTTGTCCTCTTGTGAAACCAGCGCGAGTCCAACTGGAACGATGTGGTTGTTGTAATCTTTCACGGTAGCTACCAGATAAATGCCCTGTTCGTGCATTTCC
TCTTTAAGGTGGACCCCGTCAAAGCCGACCATCTTTTTGCAGTTCTGGGCAATGTGAATACCAGCGTTAGGGATGAAGCACGCTCGACCAAACGACGATC
CGTCCGCGGCAGTTTCCACTCTCCAAACCGATCCGGGGTTCTTGTGCGCCATCAACTCGAAGTACGCCCGCAGGTTTTGGTAACTTTCTACCAAGTCGCC
GTGAATTTTGTCGTCAATTTTCTGCTTCATTCTGGACACCGATGTAGCGCTTACGTCCGCTCCTTTCGATTTCAGAAAATTCCTGATAGCGGCCCCTGAC
ATAGAAGCCGCTGATCCATCGTGGGCGGGAAGCATCTCGGTCTCGACAATCGCTGTCACCTTGCTTATCTGCTGCGTGGTATTCCGCATGGGCTTGGACG
GCAACGGGATGGACCCTTCAACACAAGGGGCCTTGGCACTACCAACGAACTTGAGGTGATTGTACGCAAAATTCGCCTGGGTTATCTTCCACTGCCCCGA
TTTCCCGTGAACATTCACGAAAAACGGACACGTGAGTTGGGCAGCTGGTGTAGTCCGGTCGAAATATTGCGTTCCATTGAGCGCCTTGCATGCAAATTTC
GCATTACCGGAGTTGTCGGCCTTCACACTGGTCTGCTTCACAAAAATCTGGAAGCCGCACCTCACAGCCAAATCTTTGCACTTGCTGTGGACTGCGTTTT
GTGAAGAAAAGACTGAATTGGCAATATTCTCTCGGAGCTGGTAGGCCAAGCCATACGTTGAGCTTGTCGGGTTCGTCGACTCGACTGCAACATCGTCCCT
GAGTAGTCCCAACTCCTTGGCAGCTTCGAGATCAGACACGTCGAGTGAAAAGCGAGCAGAGCCGTAGTTTGGGGGGTTTCTTGCTCTTGACTTGGACATT
TGCACAATGCAGTAGAATATAGCTGTGAATCACCCTTTAGAGAATTATTTATTATTCAAGTCTACTTGGTTTTTATTTAGCACTAGCCTTCGAAATCTTA
CCTCCCACGTATCTATTTCAGGTGTCCCGCAAATAAACCGAGAGCTCGAAGTTAGCCCATAAATGGTTGATAGGTTCGCAAGTGGCGTGCCGGGCGTACT
TAGGATTTTTTTACTGTATGAAGAAAATGGCTGTCGGTCTGGGGGGCGATCCAGTACTATTCTACTGGATCATGGTAATTCCTCGCGGCTGGTTCTTGGT
CATTTGCATGTAGCCATGTCCCTTCAAGGTGAAACGGCCGTCCAAATGTCGCTCGCGCAACATTCACGCAACACGCAAACGCCACATTCCACTTCACGAC
GTCATTTGCTCGGTAAACTGTACATCGCTTTTAGTGAATCTGACCGTTGTTCCACGTCTGTTCGATGAATTCTGCAAGATCTTGCGTTGCCGACCAGCAC
CACAACGTTTTCCATCGATGGCGTTCCACTAAGTAACCATCAGTGCGTGTCTTTGATGCGCTCCGCCAGGGCACCGGCCTCATGCAGAACTGTGGCTCCT
CGCAGGCCTCGCTTCGCGCAGAGCTCAGAGCGGCACAAGCAGGCGAGCACTAAGACGCAGAGCAGCATGGACCTCCTCAACGCGGTGTGGCGCTTCTCGG
TCGGCGGCGACAAGGACCTGGCGGCGGGCCAGCAGGCGCTCGAGCGCATCCAGCAGCTCCTGGTCACGGCCATCGCCAAGTACGACGGCGAGCCGCACGC
GCTCACGCGCGAAGAGATCGCCCCCGTCAAGGCCATCTGCGACCAGCTCTTCCCAGCCAATTGTGCGTTGCTACAGGGCTAATACCCTAGGATGGACAGG
TAGGAACCTGACTGCTCTCTGGGTGCTTCAGTCCAGCTCAAGGTGCCAGGATCCGACGACGACGGCGCGCCGGAGCGCCCCAAGCACGTGCACTACCAGC
ACGTCTATGAGGACGAGACGTTCTCCATCGGGTACGGGGCTGAAGCTTGAGTGCAGAATCGATATTGAGCCGGCCCTGACACTTGTGTTCTCTGCTGCAG
GATCTTCATCTTGCCGCCGGGCGCGTCGATCCCTCTGCACGACCACCCGGGCATGACGGTGGTCTCTCGCATGCTCTACGGCTCGCTGCACATCAAGTCG
TACGACCTCGTGAAGGACGGCGCTACTACGGCTGCCGTTGGCAAGAAGGTGACAGCACGTCTCCAAGCAGACGAGGTGCTCACGGCCCCGCACACGACGG
AGCTGCTCCCCGACTGCGGCAACCTCCACCACCTCGTGGGCGGCGACGACACCGGCTGCGCGTTCCTCGACATCATCACGCCGCCCTACGACTCGAACGA
CGGGCGCGACTGCACCTACTTCCGCGTCGTCGACTCGGCCGACAGCCACGAGAACAACAGCGAGGGGAAGCTCGTCACGCTCGAGACGTTCAACCCGCTG
GACTTCGACGTCCTCACAGAGCCGTACCTCGGCCCGCGCCTCCAGCGCTACGTAAGCTAAAGCAGACACCCGTCACCCCAACTCACCCCAAGTATCCCCC
TCCCATCCAGCAAACTCTTCTTTAAGTACAGATAAAACAAGCAAGGCATAGGCATACTTGGTGGAGCCTCAAAGGAATGTCATTCAACTAAGAGCTGTAA
AGAGTCGCTTACTCCTGAGCACGCAGGATGTCCGAGTCACCGGCGTCCAGGATGCACATGCACGACACGCGGAAGTACTTGCCGCAAGCCGTGCCGAGGT
CGTTGTTGTTGCCCGTGAAGTGGTGCACGCCCGTCTTGGCCAGCATCGAGTAGTACTCGACCTCCGACTTGCGGAGAGGGGGCGTGTTGTTGGCCAGGAT
CACGAGCTTGGCCTTGCCGCTGCGCAGGTTCTTGAGCGTCTGCTTGTAGCCCAGAGCGACCTTGCCGGAGCGCATCACCAGCTGCAGGCGCGAGTTGATG
TTGTCCGCGGACTTCTTCTGCTCATCGTTCACAATAAACAACGCCGTCAATTAATCCCCTACGAAGTTGTTTCCTCCATCGAACAAGCGAGAGAGCGCGC
GCTCGTCCCCATCCGTTCGACTTCGCAGGAGAGTCTCAGGCCGTCAGCGCCAGCACGAGGGCTGGCTCTGTAGTCGACTCTACAGCATCCGCACGCCCAC
TCGACCGTTGGGTTTGACACAGGAGCGGGCGGCGGCGCAACGCGATGCGGCGCGGACGATGG