Description :
From Genome Similarity Track
Location :
Scaffold_38:21663- 23240
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_38-fgenesh-gene-0.16Aminotransferase

Sequence
1577 bases(100 bases per row)
TCGAGCAGCTTCTCGAGCTCGACAACGTTGAGACCATCCTCATCCATCGGGATCTGACGCACGTTCATCTTGAAGTCCTTCATGATGCTCAGCGCCAGGA
AGTACGTCGGTTCTTCCATGAACACGAGGTCCCCCGACTGCAAGAACAGCGAGCAGAGCAGCGCCAGGCCGCCCGTAATGCCGTTGGTCACGAAGAGCTC
CTCCGGGTTCACAGGCGCGTGGTAGCCCTTGGACAGGAAGCCCGCAAGCGCCTCGCGGAACTTGGGGTAGCCCATGATGTGACCATACTGCAAGTACATC
GGGTCCGTCTCCGCGAACTTGAGCGCCGCGGCCTCGCGGATCTTGTCGAGCGGCAGCATCGACTCGGCCGGCTGACCGACCTTGAAGTTGATCATCTCCT
CGGCCTTTGGCACGACATACTGGCCGTATTCTCCCATGATGGCGGTGGTAGTGCGGGTGCTGGAGGCGGAAGAAGAGGCTCCGACGGACGCGGTGCTGCG
AGGCGAACTGTCGAGGAATGAAGCGGCCGCGTCGAAGCGGCGGCAGCCATGGGATCGCGGCGCATGGGCCGAGAGATTTCTTGTGGCGGCGGAGGGGCCT
GGAATTATGTGGCACAGAGGTGTCACAGGTGCTGATTCGCCAGAGACTGGACGAAGATCGCGCATCAAATCAGTCGAGAGTGGGAGCTCAGCGACTTAAC
TGGGCAAGGCAACCTTAAACTAGGATTGAAAATGGTATTGTTGCCAACGGCGACTGTGACGACATGCGCAAACACTGCAACTTCTGGTCATAGATGGTGT
GGTGGTACGTCAGACAAGGGgtCGGTTtGCAAGACTCATAGTGTTACGAACGGATAGGGGAGGCCCACTGAGATGTCGgTTACGAGTTGTTAAGGTAGTT
TGATCAGCGTGCTCTGCTCGAGATGGAGCACATAGTCCGACAGCGTCTCGAGCTGACGCAGTGCGGCTGCTTGAGATGGCGCACGGGGAAGCACCTTGGG
gCGGATGAGCTGGTTGGTTTGGTCGATCTCCCAGTCCAGAGTTGCGCAGTCTACGATGCGAAATGGAGGTTAAAGACTTTGATGCCCGCGTGCACGAAAA
ATGAGGCGACATACATGAAGTAAGGGATGCTTCATCACTGAAACCAAGCGCGTGCGTTGCGTCTTTGAAGCTAATGGTCGCGTATGCCGAGCTGAGGAGC
TCCGCAGTTGACTGACGGGTGGAGGCTACGTCGGCATGATGTGCTTATAAGTGGCCAAGCAGTCAACATTGTACCCAATGAGACGCACCTCGCAAAGCTT
CAACAAGCTGTGCAATTGTGTTTGACCACGTCTTGTTCATGGCGGCGTATGCTGCGGCAAAGTCACTGCGATCCAAATCAAACAACCTACATTGAGTACC
CTAcAACCCTCTTTCCACATACTCCGTTCTGCGTATAACCTACCGCATCCACAGTGCCTTGCCAATCGCCCATACATCTCCAAGTAATTGACAGCCTTGC
TTGGTTTCGTCCGCGATGCGTTTCCACAAGAAGCGCGCGTCGTTCCTGTGAGCACCGCATCCCAATCCATCAGATCA