Description :
From Genome Similarity Track
Location :
contig_43:216611- 218012
Transcript NameFunction/comments
g6360.t1hypothetical protein

Sequence
1401 bases(100 bases per row)
GTCCACGTCTGTCTTGCCGGCTCGGAGCTGCTTGATGATGGCCTTGAGTCGGTTTACCTGCTCGCTTTCCGAGTTCTTGTTGGCGTTGTTCGTGATGAGC
TTCACGCGCGAGGCGTACGTGAGCGACGTCACAGTCTCTTCCTGCAGAAATTGACACGCGCGTGAACATGTTGAACAGCGTAGTCACTCACGACAAAGCC
AAGACGTGCAGTCATACCTGGTTGTAGTCGGCTGGCGAGATGTTGACGAACATGAGCTGCCGGATCAAGACACAACAGGAAGTTAGCACCTTCCACTGTC
CAGAGCTGATCGATTCGGGTTACCGTTTTGGCATTGCCACCGAGAGAGTCCTGCATCAGCTGCGTCAGCTGATCAAGTGGCAAAGGACACAGAACAATGT
AAGCTCAGTTGCTGCAAGATGCTGCGTGGAAGTCGCTGCTGGTACCTTGTTGTTACGGTACGGGATGAACTTCTCGTTGGTCGACAGTGCCGAGATCACG
TCTCCTAGCGCTGCAGCCACAAGAATGGAATGTGAGTGACGGAAGACTAGTCCAAGTTGCTCTCGGAACTTACCGCTGAGACTCTTGTTGATGGCTTGGG
CCTCCTTGAGGCGGTCGGCTGTTGCACCAGTTTTACCAGCGCGCTCCGACCCGGCAAGATCGACGAGGCTGAGCTTGCCGATCGTGGTGGCCTTGGTGGT
TTTGTTGTAGCTTTCCACCAGCAAGGAGAAGATGGAGTGACTGCGACTGCTCTCGGCGTTCATCTTGGCACCGACTTGGCGCTTCTTGTTGGCAGCCTCG
AACAACCTCAAGGTTTGTTCGGGCGAAGTACACTTCTTGAACGTGGCATTCTGGACGACGACCATGCCCTTGTCATTCTTCTTGATCTCAAGCTTCGTGT
CGTGAGCTCCGCCGCCTTCCATGAGGTGGAACAAGTCGATGAGAGTGTCGTTGTAGAGCTCCAGCATCGTAGCCTGGAAGGAAACAGCGAAGTTGGCCTT
CACTTCGTCAGCCAGCGCGAAGAGATGGTGGATTGTTCGTGGACTCAACCCTGGATCGCGCTCGACTCCTGTCATGGTGAAGGTTTTGCCCGATCCGGTC
TGGCCGTACGCGAAAATGCAGACGTTGTAGCCGTCCACGGCGCTCTGAAGGAGATTTTTCGTGTCCTCGAAGACCTGTACCTGCGTGCTGGCGGGCGAGA
AAACCTGGTCGTACGCAAACGTTTTCGCTGCTCGGCTGCCTCCGCTCACTTCGAGCGAGAATTCGTCGAGAAACTTGACACACGGAGCACACCCACGCTC
ATTCTCTGACCCACTCATGGGGCGACAGCGAGCGTAGACGCGGATTTGCCCTTCATGTCTTCGATCTGGTTGTAGTACTTCTTTCGCAGTGCCTGCTCTT
C