Description :
From Genome Similarity Track
Location :
Scaffold_93:216591- 217802
Transcript NameFunction/comments
Physo_121578hypothetical protein

Sequence
1211 bases(100 bases per row)
AAGTGTGAAGACGTGCACTTGATCTTGAGTACGATTCCCTAATAGACAACGACACTTGGACGTTAGTAAAGCTGCCACCTGGGAGAAAGGCACTACCGTG
TCATTGGGTACTTGTGGTAAAATAACATGCTAATGGAGTTATACAACGCTTTAAAGCGCGACTTGTTGCTCAAGGAAATCATCAAGAGTTTGGAGTTGAT
GTAGACGAGGTATACGCCCCAGTGGCGAGGTTTGAGTCCTTACGCCTTGTCTTGGCAATTGGCACCATTCTAGATTGTCATATCCACCAGATGGATGTTC
ACACAGCATTCTTGAATGGAACCGTGGATGGAGACCAGCGCATATATATGAGACAACCTCCGGGCTATCATGCACCAGGGAAGGAGGGCTATGTTTGTGA
GCTGCGGAAATGCATCTATGGGTTGAAGCAGGCTCCTAGAATTTGGTATCAGGTGCTGCATAAATTTCTCACATCAATGGGTTTTGTGCGTTGCAATAAC
GAGTTTTGCATCTACGTACAAAAAGTGGGAGATGATTGGGTCATCATCGTGGTATATGTCGATGACCTGACGATCATGTCGAAAAGTATGCGACTGATCA
ACAAAGTCAAAGCGGAACTATCTATGAGATTTAAGATGAAAGACTTGGGTGATGTCCACTACATCCTCAAAATGGAAGTCCGCAGAAACAGAGAAGAACG
GACAATGTCCATCTCTCAACATCAGTATATATTGGAACTACTGAAGAAGTATAACATTGAGAACAGCTCCGCTGTAGCGACACCTCAGATTACAGGTCTT
GAGTTTAAACCTGAAACTAAGATAACTGCGGATGAGATAGCAGCTCAGAAATTTGATTACAGAGGTTTGGTTGGGCCGCTGCAATACCTAGTGAGAGGTA
CTAGACCGGATATTGCTAATGCAGTGAGGGAATTGAGCAAGTATTTGTCCTGCTACAATAAACCCCATTGGGAAGCAGCTAGGAGAGTACTGAAATACTT
GAAAGGGACGTCGACGTACGGTCTATTACTTGACGGAAAGTCAAAGGACGTAACGTATGAGGTGTACACAGACGCAAGCTTCGCGTGTCAATAAAAGAAC
GTAAATCAATCACGGGATATATGATTAAGATGGCTGGCTGCAGTATATCTTGGCGCAGTAGTAGGATGTGTTTCCCTATCAACTGCAGAAGCAGAGCTTA
TCGCATTGAGC