Description :
From Genome Similarity Track
Location :
Scaffold_191:21655- 27587
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_191-fgenesh-gene-0.2Titin isoform N2-B

Sequence
5932 bases(100 bases per row)
TGCAATCTTTGAGCCCTACGTGCATGGCCAAGTTGGGTACTACGGCGACCCGACGAACCCAGACCCGGAGCGCGTGAACGAAGGCGCGCCGTTCTCGCCC
GACACGCCGCGCGTCTTCTTCAGCGCGAATCTAAAGCGTACGTGTATATGCTTCGCTGTGTTGTTTATTGTCACGCGCTGTGCGTCTGTCCAAGTTAATC
GTGTTGCCTGTTGTTAATGCTGTTAGAGGACTGTCCGGGGATGGTCGGCCCGATCAACGACGAAGAGTACTACTGCCGTGGACGCGACTACGGCTACTGC
GACCGGCGCAACGGACTCTGCGTGTGCAGCCAGGGGTACACGGGGATCGACTGCACGCAGTGCAAGCCCTCGTACTTCAAGAGCGGCAGTCTCTGTTATC
CGAAAAGTAAGTACTTTGTGCATTGCTTCCCCCTCGTTGATATGAAGCTAGGATTGACCCTAGACTTGCTAGCTAACACAGATGATGGTGACGTTGGCTA
CAGAGAGCTGCCCGAACGACTGCTCGCAGGGTGGTACGTGCAACTACGCCACGGGCAAGTGTTCGTGCTTCCCGAGCCGCAAGGGCGACGACTGCAGCCA
GAAGTTCTGCCAATTCGACCCGCTCTGCACGAGTTGCACTAGTACCTTGTGTCTCAGTTGCGTGGAGGGTTTCTACGCCAACCCAACGACCCAGACTTGC
GGTGAGTAGTGACGGTATGCTGCATATCCTGCTGTGATTCATACTCCCATTGAGACTGACACAATAGACGCTGCTCTATGTACCAGTGTCCTGCAAGAAG
TACGACCCGCGGTGCCTGGTCTGCGATGCGCAGTCTTGCCTCGAATGCGCAGATCCACTCCTCAACTCGGTGCGACGGAGTGGAGCGCGCTTTCTGGACG
CGCCGCTGCCGTTCGACGAGCTTATGCGCGAGTTTTCGTTCAAGTTCTCGTACGGGAGCCAGGATCCGCGCGTGTTTGACGAGGCCGAGGCGTTCTCCCT
AGTGGCTCCTGGGGCTGGGAATACCAATGCCAGCAGCTACCTGAATGAATCCAGTCGGACGTGCGCTCAGGGCACGAATTCCGATGCCACCTGGGCGTGC
AAGCCTTTCAGTGTGAGCCATCGCGTGTGTGGACACGTGGGCGTTTTCTCCTTCGGGTCGTCGGTGTACGCGATCGCCGAGGCTGCGCAGAACATCACGC
TGACTGTGAAGCGTAGTGGAGGCGGACTGGGCCAAGCTGCTGTGCGTTACGACGTCCAGTACCTGAGTGCGTCGCCGAGTGACGTCTCCCCCACAGCGTT
CTACACGACCTCGCAGCTGTTGTTCTTCGACGAGGGCGTCGTGGAGCTCGCGTTCAAGCTCACGATTCACGACGATCACGTCGTTGAGCAGAACGAGACG
TTCCGCGTGGTACTCCGCCAGCCAGAGCTTGAGACCGCGGCGAGTCTGGGCAACCAGCGCCAGGCGCTCGTAACGATCCTCGACGACGACGCGACATTCA
CGGATGCTGGTTTGTCATACATCGTAAACGCTAATACAGCGCTCAAGAAAGGCGGTACTGCTGGTACCGACCTCGTGTTTCAGATCCAGAGCGTTTTAGG
CAGCGGCACGTTGAAGAAAGCGAGTGGTAGTAGTGACTTGTTCCTCATGGAGTCATACTCAGCCGACATTGAAGACGATGTGGATAGCGTTGAGGGCCAG
GCGTCCTGGGAAGTGTACCGGTCCAGGAGGCTTGGCCGCATCGTCGACAACCTCAACGGGACATACACATGCACGTGGCAGCGCAAGCACGCGGGGCTCT
TTAATGTCGCAGTGTACCTCTTGTACCCCGGCGGGCTTCGTGGGGACTACTACGACGACGCGTGGCTCGGTGAGAATGGCCGCGAGCTCCCAATCATCAC
GCGAATCGACCGAAACGTCAATTTCACGTGGGGCATTGGCGCGATCTTCCCTGGAGCCAGCGACTACGTCTCCGTGCGCTGGAGTGGTCAGATCAAGCCG
AAGACTAGTGGGGACGTGACGTTTTCTGTTGTTGCGGACGACCAAGTTCGCCTCTGGATCAGCGATTTACTATTGATCGACAAGTGGGACAACTCGTTCA
CAACAGGAAGCCAGACCAGCGCGACGCTTACTCTGGACGCCTCGCTGTATTACTCCATTGTCCTTGACTACCGAGACCTGACGGGGAATGCCCAAGTGGC
TCTCTACTGGAGCAGCGCGAGCAGTCCCGCGAAAGAGATCGTCCCCGCGTCGAGTTTGTACTCAACGCAGCATATCCAAGGAAGCCCCTTCCAGAACGTG
TCGATTCTTCCAGCGAACACTGCAAACGTGGCAACGAGTACGATTCGGGGCATGCTGAGCTCGGTCGCTGGGAACACGCACAGCTCTGAGATCTTCCCTG
TGGACGTCTATGGAAACCCGCGACGCATCCAAAACGATTCTAGCGACCTCTTTGAAGCGAGACTAACGCTCACGACAGACCAGAGCCTCGGTGGGGTCGG
CAGCAAGCAGAACGACGCATTGATCACCTGGAATTCAGCTCGAGAGGCCTTCAAAGTGACGTGCACGCCGCTCATCAGCGGTATCTACGATCTCGATGTG
TGGATTAACAGCGTCAAGATCAACGGGAGTCCGTTCCAAATGGTCGTCAGACCCGGCGCGATTCATGCGACGAGGTCCGTCGTGACGGGCAACGGGCTGT
TGATGAATCGCGTCGCCGGTGTCGCGACCACGCTGCTCGTGGAAGCGCGAGACATCAACAACAATAGGATTTATACTGGCAGTAGCGGCACAATTGGAGG
ACAGCCAAAGCTGTCCATCCGAGCGTTCCACACCACTCAGACATCGTCGATCGAAACTGGTTCAGTAGTGGACAATGGGGATGGGACGTATACGCTGACG
TACACGCCACGGATCGCTGGGAGCTACAACGTTCGAGTGCTACTGAATGACGCAGTGGATGTGAACAGCTCTCCGTTTTTAGTTAGCGTCGTGCCGAATG
GCCCCATCGGCACGACCAGCACTGCCTCAGGCTCGGGTTTAACCTCTGCAGCTACAAACGTCCAGGCGTCATTCCAGGTCACAGCCCGAGATCTCAACAG
CAATCTGGTGAAGCAAGGCGGCGCCACTTTCCAAGTGATCGTTGAGCTCTCTGGGAAGGTGAACGTGACTGGTTCATGCGGCGATTTGCTCACTGGCACC
TATTCGTGCACATACACGGCGAAGTACGTAGGCAGCTCCAGATTGCACGTTATTCTAACCTCCAGTGGTGGCGGATCGCTGCCGGTTTCAGGGAGTCCGT
TTGCTTTAAACGTGGTCGCAGGACCAGCACTGGGCTCGCTCAGTCTCGCGCAGGGGGCGGGGCTCGTGTCGTCTATTGCTGGGGTGCGTGCGAACTTCAC
TGTGTTCGTGCGAGACGCTTTCAGTAACGAGAAGCGGAATGCCGGACAGGAGACTGTGACGGTCGTGTTCAAAGGACCCGCACCAGCGACGACGACCATC
GCCGTCCCATCTGGCCTTACAGTGTCGTTCCTGGGCGACGACAAGTTCTTTGTAAGCTATGCGCTGCAGGCCAAAGGGAAGTACGCCATCCAAGTCCAGC
TCAACAGCGTGGACGTGCTCGGCAGCCCGTTTACAATGTACACGTACCCAGCAGAGGCCTCGCCTGTCACTACGTCGTTAGATTTGATTACCCCACTGGG
GACGACAATTTCCCCCTTGGTGTATACCGCAGGCGCGTTGATCACCACTCGTTTGACGACGAGAGATACTTTTGGGAACGTGCTGGAAAGCGGAGGGCAC
GCGTTCCAATGGGACGACGAGGTCCAAGCCTTCCAGGAGAAACCAGTGTTCGATGAAGTGAACGGGAGCTATTCGCTCTGGCTCAAGCCCTTGAAGACCG
GAGTTTTCCCATTCCAACCAAGGATCTTGCTCAAAGGCGGGCTGAATGCGAGCTATTACCCGAATCCCGACTTCGTGAGTCCGTCGGTGCTCAAGAAACA
AGATGCCCAAATCGATTTCGACTTTAAAGTGAGTCCACCGGCTTGGACAGACACGATGGAGACCTTCAGCGTGCGCTGGAACGGCTTTTTGCTGCCGGCA
TACAGCGAGATGTACACTTTTGAGACCGAGGTGCTCGGCAGCGTGAGTCTCTCGGTGGACGGCGTGTCGCTGCTGCTCGCTAATCTGCGCCCCGATGCGA
ATCACACACAGTCCAAGCAGCAAGCCCCCCATGTGTACCTGGTTGCGAACCAGTTTGTATCGATTGAGCTGAATTACACCAAGCCAAAGCAGTTCTCGAA
TGGCAAAATGCGTCTCTTTTGGCAGAGTCTGTCCCAACAACGTGAAGTTATCCCTTCGAGTCGCTACTTCACGTCCTGGCGCATTGTGAACAACGTCCCG
AGTCTCAACATCCTACCCGCGAGTGCGAATCCGCCGTCGTTCACCGCCGATTTCCCGTCCAGTTCGATAGTGAAACTCAGCGAGACTCAGGCAACAAGAT
CCTCTTCACTGCCGATAATCCGAGCAACTGCAGGGGATAAGTTTGTCTTCCGTGTCATCGCGAGAGATCAGTTCGGCAACAGAAGATTCGTGGGCGGCGA
CATTTTTCACGTCCTATTTCCTCAGTTGCCTGTGGACGTGACGCCTTTCCCACTCAACATTGTTGATTTCAACAACGCGACGTATGAGATCTCATTCTCT
CCGATATTGAGCGGCACGTTTTCCATGGTCATCGCGGCGACGGATCCAAGTCTCACAGGGCATCAAGCGCTTGACGGAAACGCGCTGGCGCTGTTCCTCC
GTCCGTATTATATTCGGCAGAGTCCGTTCACGCTCATTGTCGAGCCGAATGCACCGCTAGCGACAATGTCGACGACCTCAGGGATCGGATTCTTCCAGGC
GACGGCAGGCAAAGAAGCATCGTTCAACATCCAGCTTCGTGATCTGCACTCCAACCCGATCGATGGCAGAGGTGGTCTCATTCAAGCACTGCCTCGAGTG
CAACTTCGTCTTGGAGGCACAGCCCCAACTGATCCGGTTGTTGCCACTGTTGATGCCACAGCGTCGAGGTCTCAAGATGGTACCTTTGAGGCAACGTACA
CTGTGACTCGGGCAGGTCTCTACCAAGTACTCCTCAGCGTCGATGGTGGAGCCACCTTTGCCTCCAAGAGCTCGACGCTGCGGGTGTATCCAAGCATTGC
ATCAGCGCTGACCTCGATGATCACTGGAGGCACGGGACTCGGGCCTCAGATTCCAGTCAACCAACTGCAGACCTACAAAGTCACCCTGAGGGATTTCTAC
AGCAACTCAAAGGGCATCGGCAACGATAACCTCGTGGTGGTGCTCAGAGGGCCCAAAATCGTGTACCCACAAACCATCACAGACCTCTCCACCGGCGAGT
ACGTCGTCGCGTACATGGCGAACCAGCCGGGGGTGTACGAGATCCAGACGTTGGTGGCCAACCACGGCCAGGGGCTCATCGGGAGCTACTTTGAGTCCAC
GCGGTTCGTCGGCAGCTCCGCCACCGCAGCTCAAGTGGTGGATGAAAAGATCGATTTTGACTGGAAGACCAACGAGACGATGCGCAGCTATCCTCGCGTC
CAGTGGAGAGGGTTTTTGAAACCAAAGTACTCGGAGGTGTATACGCTCTACTTGAAAGTGTATCCCTACGGTGTAGTGTACATCGACCAGATCCCAGTGG
TCGATGCGCTGAACACTCCGTTGGCTGAAGGGACGACTGAGATCAGTGGAGACGTGAGCTTGTACGCTGGCAGACTCCATGCTATCACGGTTGAGTACCG
AAGTCCCTCGGCACGAGAGGTCTTTGGATTTGTATCGTTGGAGTGGGAGAGCGACCGCCAGAACCGGGAGGTTGTACCATCGATTGCGCTAATCCCCGGC
GCGCAGGAGATTCATCCGAGGTACACGGTCGT