Description :
From Genome Similarity Track
Location :
Scaffold_1:21655- 22856
Sequence
1201 bases(100 bases per row)
GGCTCGTACCTTCTGAGCCACGGCAGTCCAAGGATAACATCGAATTTGTCATCCAAGTCCAATATGATGAAGTCATCATCGTATTGGACTCCCTTTAGTG
TATAGGTAATACCCACTACACGTTTCAATACTGTCACGGATGCGCCTGTTGCGAGGCGCACCGTCATCCTCGGTGGAGGGATCTCGCGCTCGATATATAG
CTCGTGATTATCTAGCGATTGGCGTCGTACGAAGTCGTTTGATGCTCCAAAATCGACTGGGGCTCGTAGTGGCATATTTCGTGTCACTTCGAGTTTCAAG
GTAATGAGGGAAACCTCATTACCAGAAGCAGCAACACACAATGATTGAGTGTTGGGAGAAACTTTCGTCTAGAGGCCTGCAAAATCACTCGACGTTGCTG
GATCAGTAGGGTGCTCCGCACCTACTGACCCTGACCATTTCTTGGCTGTCCGTTTCGTTGTTGCGTCTTCGCAACAACTACGGACCCACGCCTTGGACCT
CTCTTGGCCGCTTGGCGGTTATTGTTTCCTGCGGTACGTGGTACCGCGCTCGGGGCACTGCATTCGTATGCATAATGCCCTGTCTTCTGACATCTATTGC
ATTTTTGCAATTTCTTGTAATTGTTAACACGAGAGCTCTCGCTCCCCGCGTGACAGAGGTCCATTGGTTCTGGGCCTTCATTTTCCTGTGTTCTCGATGG
ACGATAAGAATTCAAATTCGCGTGAGCCTGTATCACGCTGAAGTCCTCCTGTTCCGCAACCCTTATCGCCTCTTCTAGGGTGTTGAATTCCAACCGGAAC
TGGTAGGTTTTAACAGGACCATCTGTCAGACCCTGCATGAACAACGTAATCAACTTTTGTTGATTCAGTGGGTCGACTGTTATGCAACTGGTAAGGTGAC
GTATGTACTGAATGTACGAGTGTACGTCACGTTTATCTTGCTTAATTCTCAGGAGTTCAGAGCGAGCCCTGAACTCAGCTCGCGGCGGCTCAATAGTTTA
CCTAAGCAGAGACTTGAAGACTTCCAGCGACCAAAAGAAATATGGGTCGTGTAACTTAAGGCCCAAGGCCCACGTCTTTGCACGCCCTGCCAAGTTCGAT
TGAGTAAATGCGATCTGCATTTCCTCATCGACGATATGACGAGCCCTGATGGCATCGTCTAGTTCCACGAATCATCTTAACAGGGAGTCTTCATCGGCTC
C