Description :
From Genome Similarity Track
Location :
Scaffold_72:216513- 217980
Transcript NameFunction/comments
Hyaar_Emoy2808019hypothetical protein
Hyaar_Emoy2808020hypothetical protein

Sequence
1467 bases(100 bases per row)
AGTTACACCTGCGGGGCTTCCACCAGACAGAATCCCTCGCTACACTCGCTGCTCTTAGACTGTACCTCGAGCACGTAGCACTTGTCCGTATCACCAGCGG
GTGAGGCTACAGCCCCATTACGTCGGGCAAGACGAGTTTCGCGGATGAAGTCGCACATCGAAATCTGGGCCAAGTCGTCAGCCAGGCTTCTTGTTTTGGG
ACTCTTCAACACCATGACCTTTGTGTTCAAGCGACGATTCGCTTCGGCTAGACAAATACCAAGACATTAGCTGGCAAGCATCGACCAGACCGAGCAAAAA
AGAACGATAACGCACTTCGTGACCGCACTCCGTAGAACTGGCAGACGCTGTGTATAATCAGACGGTGAAAAGCCGAGTCCAGCAGGGGCATGACCAGGCG
CACATCTTTCTCGCATACCTTCACCAACTCGATCGGGTGTTTCAGCATGTGAAACAGCGGCGCCGCTATTTCCAGCTCTGACGGAACCTCTCGCCACTAC
AGCAGATGGCCACACATATGGTCTTATTAGTACGTCACGTGGTACCATCTCCTGCCAATCATCTAGGACGTACCTGAATGAAGTGCAAAACCACACATTC
AACAGCTTCGATAAACGGCGCTAACGAGGTAAGCGACCGCAGAATCAACGTGCGTGCCCGTCGATCGACACGAGTAAACATTTGCTCAGCATCTACACCG
CACCCAACACCACGTCAAGACCAGTATTACCACCCACCACCTCACAGCTCCACCACCACCAACACACTTACCGTTCCACTTGTCTTTGCGTCGATTACGT
GGTCCATGGGATACATTATTTTCCGGTACGCATCCACCTTGACGGAATTCAGCTTGCAAATCTTCATTCTGCGGCTCCGCCAGCTTCTTAAAGTTCGACC
TAGCCAACATCCACCCTTCAACAGTCAACACCACGTAATTCTCAACAACCGCACACAAATAGGTGCGTCCTTGTACCCACCTCCACTCCACATGAATGTT
CATGTGCTCCATCAAATCTTCCAACCCCGTTGACGCCGCGCGATTCCCGAAATGGTGATCTGTCAGCACACACATAAACAACACACCACATCAGTCCCCT
ATCCCTCCACCTTCTACTCCTTCACCTCCTGCTCACCGTTCAACCACCGCTGCTGTTTGCGTGCACCCAGTGGCAGTTCATTCGGGTTTGACAGATGTCC
AGCAGACCGGATAGGGTGGATATTAAGCAGTCGCTTACTACCACCAGCAAGCGGCGACTCACTGCCCCGTCTCTTGGGCGTGTGGGCACGAATGCCTTCA
TTACGACTGCTGCAAGAACGCTGCTGAACGCCAGCGATCATGCTCTTCTCGACCACGCCGTCTTTTGTCGCGGGACCTTCAGTCCGCAACGGCGCAATGG
GTCCCTCTCCCCACGCCATTTCCAGCTCCAGCTCACTCTCACAAAGTGAACTTTCTTCCGAGTCGCT