Description :
From Genome Similarity Track
Location :
Scaffold_1876:2165- 3567
Sequence
1402 bases(100 bases per row)
CCATCCGTGCAGTCTCCACAGTATTGCACTGTATGCTCCTCCTCCGCGTCGTATACGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCATCCACC
TGTACCGTCGGAATCGGGATCTGGATCTGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGTGTGATGCTCG
CGGACAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAACCGTCCTTG
CAACCCGGCCGACTTGAACAGCCAGGCTAGCGTAGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACTAGCAGGTTGTAATTCAGATCCAACACGCGC
AGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGCTCAGTTCATTCGGCTTCAATGACCGGCTGACGAAGGTGACTGGATGACAGATTCCTTCATGTT
CTTGTACCAGAGCTGCTGAGATTGCCCAGTCACTGGCATAAACTATCACCGTAGGTTGACGTTCCGGATCGAAATGACGGAGGATAGGCGTGGTCGCGAT
CCTGTTCCTCAGTTCCACCAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATGCTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCT
CTCCGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCGTACCACTTGGATTCCTTCGTGGATCCGACATCTCCAGGGCCAGAG
CTTGTTGGATTTTGATCCGGACAGCTGAAGTGGTCATCGCAGCAAAATCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGAT
GAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAGCGACTGCGGGAAGGACAAATCGGCTAACGAAGACAGGTCCTTAGGATTC
GCCTCCAATCCCTCCTTGGAAACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTAATAGAGAGATTCCACTTAGTAC
ACGCCTCCAGTAGGGATGTCACTCTTTCACACAACTGATCCCACGATTCCGCCGGAATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGACGG
GGTCCCAGGATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCCGTATTGCCTTCCCCGGATCCACCCGTTTCGGGCTCCGGTATTCGGGTGAACCCA
TAGAGGGCGTTATCGATTAGGCGTTGGTAGATCTGGGGTGCGCTCTTCAATCCAAACGGCATCCGGGTCCACTCGAACAGGCCAAACGGTGTGATGAATG
CG