Description :
From Genome Similarity Track
Location :
contig_1:21648- 26588
Transcript NameFunction/comments
g2.t1hypothetical protein

Sequence
4940 bases(100 bases per row)
GCAGGTTGCCCTGGATCAGCTTGCTCGTCCCACCGTTCCCCGTGCTATCTGGATCCCTGGATATTGCGCTCGTTCTCGTAGGGCGGCAGCGGACGTTCGC
CCGTGGTCGGCGAGCACCTTTGAGCCGGGTCAGTGTCTTGGAGATGGACATCGAGTTGCTCTTTCATCACCTGGCAAAGCCTAAAAACTGGCTTTTTCCG
CCGCAGAGTCGATCGCCTCGTCGCGGCGCTTGGTCACCCGGTCTGATCACCGAAAGCAACATTGCGGCACTTTACGCGACGACGCCGTGGAATTCTCTCA
ACGTCTTGGTGACGCCTTTATCTTTTGAGGTGACTGGTTGGTTCGAGGCGATGTCTCGGAAGTATCTGGAAATTGAAGATGATCACCGGCAGGCTCTATG
GGAGGCTACGCACGCGTTCATGATCAGCTCCGCGCTTCGTAAATCGAACACATATCTGGCACGTCTTTGGGAAGATCGCAAGCAGAGACGATCACGTTCG
GTGCCGTCTGGAAACGCTTCCTCAAGTTGATCTTGCAAGGGATGATTGCAGGGCACTGCGACTTGGATATTCTGCTGGACCCTTTCTTTCTGCATTATCC
CCGGGCGCACGAACAACGAGTTTGGTACCCTGGCTTGGTTGCAGCTCTCGCCTCCAACCTGGTGGACGTCCTACGTGCCGTCGATCTGGTTGACCCGTGG
CGCAATCAGTATCGCGGCCACCTTCAAGATCATCCGGCTCCCAACTGCCCCGCCTCACCGGCAAATTCTCTCCTGTCGCCGACTAAGATGAGGTAGTTAG
TGGATCGTATATCTTCTCAATATGATCTCACGGCTTCTCCCTTCGTTGTTTTCTTCATCATTTTCTTGCTTTATCGAGCATCCCGCTCCGATCGAGAACA
GTCGTCCTCGATCTACACAACAATATCACATAAAACCCTTCCACCTCAATGTGCGACCACCTCACACATTGTTCACACCACTCCTCCGCCCGCAACAGCC
AACCTGCTACGAGCTCTCCTCCTCCACCTCGTGCGACTGCATCAGCGAAGCGATTCCGGTTGACGACTCCTCGCTCGTACTCGCGCAACAAGGCTCCGCA
ATTCAGATCGGCTTCATCAACCCACGAAAGCTGATCGTAACCCTTCCAGCGCACCTGAAATTCCCGGTGGACGCGACCATATCGCGTAGTCGACCTGATC
GCATATTCACGATCTTCTCCACCTCGAACTCGTCCTCATCGAGACCGCCTTCCCAGCTGTCCTCGGGTAAAAGCGCCTCATCAAAGTCGAAGCGATCGTC
TTCGTCCACCACCAGCGTCAGCGTGGGGCGATCGGGGAACGATCGCACAGGCTTGAGTTTTGACACATGGACGATCGGGAATAACCGATAGTTGGTGCCA
GCGACTTCCAACCTTGCTGCATGATTGTCAAGCATCTCGATCACCCTGAACGGTCCGTGCCACATGTGGGCTAACTTGCGTGCATAGCCTCCTTCACGCG
ATCTAGGTGCAGCCACACTTGCATATTGGCCTCAATCCCATGAGGTCGGACCTGATCGTTATGCCCGTCTGCTCGTCCTTGATGGCCTCCCGCAGGGACT
CATTAACCTCTTCTCTGGCTCGACGATAGTGGCTCTGTATATGATATCTCCACCGACGAGGGTCACGATCCCGGCGCGTGCTTCCGAGAGGTAGCGACGC
TTCTAACGTAGATTGCGGTCCCACCCGTGTGTCAAGTAGAACGGCGTATCTCCTCGAACCCGATCTTGGGCCGTGTTGAGCGCGAACGTCAGTCACTCCG
CGTACTCATCCCAGTCCTGTTGGTTGACGTCTGCGACATACCTCTTCAGCGCACGTGTCAATGTTTGCACCATCCGTTCTGCCGTCCCATTGGCCTGTGG
ACGATAAGCCATAGTGGCCCTCTGTTTCTGTCCCACTATCCTGCTAAAAGCACGGAAAAAATCAGACATGAACCCAGGTTCCCTGTCGTGCCGGATAGCC
TCACTGGCTCCAAAACGCCGGAAGACGCATTCCTCGTAGTTCTCCGCAATCGTCTGCGCTGTTCTTGACGCGCTCGCTTTAGCGATCACATAACCCGAGA
ACAGGTCTACCCAGATCAACAGCTCCGTATTGCCTTTGAAGGACTTGGGCAACGACGGAATGTGATCCATAGCGATGATCTGAAACGGGTACGTCGCTTG
CACGTTCCCAGGGGATTCTCCTCTCACGAAGGGTCGGCCTTTCCCTGTCTCACAATCTGTACATTCTCCCACATAGCGCTGAACACTTCGGTATAAGCCC
CTCTAGTGGAAGTGTGATCGGATTCGTCGGTACGTCCTTCCGATCCCTTGATGTCCCCTTCCAGACTTGCGTGGTATGATGTAGAAATCTTGTTGCAGGG
TCTCAGGCACCACCAGCTTCGCGATCTCGTCACGGTCCTCCTCCTGCCGCATGGCTGACGGGCAATAGAACAGCAGATCGTTTTCGTCCAACTCGTAATC
GTTCGCGACCTTGGCGCACGATTTAGCTTCGGCCGCGGTTAGAGCCTCGACGTTCCCTTTCAGGTATGCTTTCAGATCGATGATCCACTTCTCTTCGTCT
GTGCTTGGATGATTCGCTCACCGCGTATGCGCTGTACAATCGCTTCTTGCAGGACTTCAGGAGTCAGTCGTCTGCGTCGCGTCGATCTGGTCACAGCAGA
CACACGGACGACGGCATCGTCGTCCCTCATCTTGAGGAGCTCGTCCAAACGGTTGAGCGTGATCAAGTCTTGTTGATCTTCGTTGAGGTGACTACGACCC
TTCGCCCGTTGGAGAGCTTCACTGGCTAACTTGTCTGCACTCTGGTTCCAATCTCGTTTCATGTGTAGGAACTCGTGTTTTACCACGACTGAGTTGATCC
ATCGCTTCTCTCGCGCAACAACAACAGGCCAGGCTTGCATGCGATCTCACCACGCATTGCCGGATTAACTAAATTGAGTCGCCGCAGATCACAATCCGCC
CTGTCCATCGTGGACAGCAGATCGAAGCATAACAACAACCCGCGGTACTCAGCCTCGTTCACCGTCAGATCGGGCATATACTGATGCGGCGGTTACGATC
GTCCACTCTGGCAACTTCCATATGATCGCACTGTAAGCTCCACCACTGCGTTTGACACGCGTGCCGATCCATCGAAGCTCGCGACCAACAAAGTTTCGTC
CGCTCGATTGTAGGGTGGCATGGTAATCGTCTGTCGGGGCTGCTTCACGGGTGCAATCGCGATCAACGCCTCGTCTACTTCCGCTTGAGGTGTGATGCTT
GCTGCCATCGTGCCTAAGATTTCGTCTTCCCCTTTCGTGCACTTCCTGATCTCCAGTGTCCATTCTGATAGCAAGGCTGCCCAATTGCCAAGTCTCCCTG
GAGACCGGCCGAATTGACTAACCAAGCCAGCGTCGAATGCCTGGACAGCACCAAGATCGATCTCGTCGTCAGCAAGGTGTAATTCACGTCCAGCATCCGC
AAGAGCGCCAAGAACTTCTTTGTCGACGATCCCGTAATTGATCTCATTCGGTTTCAGGTACGACTGGTGAAGGTTACTGGCCAGTACACGCCATCATGTT
CTTGCACAAGAGCCGCGGAGATCGCCCACTGACTCGCGTAAACTACGATCACCGGAGTGCGATCTGCGTCGAAATGCTTCAGGATCGGGTGGACACGATT
TGGCCTTCAGCATCGTGAACGCGATCTTCGCTCGGGCCCAGCGGTCAGCGTCTTCCGCTCGCGGGACATCGCCCCCAGTACTTGTTCGCTGGGAATGGAT
CTGTCCTGTCGGGCAATCTCGTGGAAATCCGCTTCACGCAGCTCGTACAAGACGGCGCATAGATCGCGAAGTCTTCGATGAAGCGACTGTAGTAGTTCAA
GCTTCCAAGGAAGGACTGCATCGATCGCAGAGTCTGCGGGAAGGGAAGGTTGCCTAACACTTCAAGATCTTTTGGATGGGCTTCCAAACCGTCGACGGAC
ACTCGGTGTCCCAAGTAGTCCACTTTCGTCGGCCCCAGAAACTTTTGACCACACTGATGATGGACAAATTCCATCGTTCGCAAGCATCGAGCAATGCTTC
AACCTTCTCACACACAGCAAGTCCCAAGTGATCGCAGTCACCAGAAATCATCGATGTACGATCGCTTCCAACACTGACGGTTTCGGCTCTAGTTCCGGCT
CGCCTGAATCGAACACGTCGATCGGTTCGACGGATCGTGACCGGCGCGGATTCGGAAGTGTCCATACAGCGCGTTATCAATCAACCACTGGTAGATCTGT
GGCGCATTCTTCAGCCCGAAAGGCATACGCGTCCACTCGAACAACCGAATGGCGTGATAAAAGCGGAGATCTTCCGTGCGCGCTCTCGTCATGGAGACTA
CCCAGAAGCACTTGCCATATCGAGTGAGCAATACCAGAGCACTTTGTCCAAGTCTTCCAAGAGATCGCTAATCAGCGGCATGGGGTACACCATCAGTCTC
GTCAAACTATTCACCAGCCTGTAGTCGATACAGAGCCGGATGTCAACGCCGTTCTTCTTGATGATGATTACGATCGGAGAGGCCCACGGTGAAGTCGACG
GCGTGATCATCTTCGCCGATAACAGGCTCTTGATCAGATCCGACAGCTTCTCGCGAACTGTGGAGCGACTTTTCGGACGCGTTGTGCAACAGGAGCCGCT
CCTCCCACATCGATGTCGCAGACTGCGCCAACGGCGCCGGCGGTAGCGCGTTCCTTTCCCGATCAGAAGATGTTTCCGTCTCCAAATTATCTGTCGCAGC
CGATCGATTTCTTCCGGGTGTTCGACTCTGGATCGCCCACTGGATATCTTCGATCGTAACCTCATCGGTGGCAGTCACTACTTCTGGTAGAATTGCCAAC
TGACGCTCCACATCTTCAGCGAAGAGATCGCCACCTTCGT