Description :
From Genome Similarity Track
Location :
Scaffold_44:216462- 220208
Transcript NameFunction/comments
Hyaar_Emoy2805966hypothetical protein

Sequence
3746 bases(100 bases per row)
GGCTCTGTGACAGGGAAGCAGTTGTTGGCCAATCCATTCATTCTTCGTTCTCATCGCATGGTCAACAATTCCATGCGGTGTGCAGCCAAAGCTGCTGAGA
ACGCAGCCATGAGACTTCTCTCTGCTGAGGCAGGAAAGACAAGAACACCTGAAGCAGCTGACGTAAGTTCGTCTGCTGCTGCAGGCGCGCGCGGCGATGC
ACTGCGTGACATCGGAGATTATGAGCTTTAGCTCATATACTCTGGCGAGTCTGACGGTGAGACCGACTCGAAGGAGGCGAAAGCCAAGGAAGAGCCAGGG
TTGGCTAAACCGGAGCCGACTAAGTCGGCTTCTCGAAGCGCTTTAAGCCTTGAATACCGTCGTGACATCTTCGGATCGTCCGACGAGTCCGACCCTTCGT
CTCCGAGACGGAGTCGTTCTACCGAAAGCGAGATATCCTATCGGAACGACCGTGACGGTGATGCAGTCATGCATCATTGTCCGAGTGATCGGGATGATCC
TGGTGTCGGTACTTCTATTGACACCAGACAAGAGACTGTGGATCGCAACATCTTGCGTGTTGCCCCCTAGAAGAAGCCGTGGCTACCTTCTCAGAGAGTG
TTGGCTCGTCTGTCTGACACGACGAGTGATCGTTATCGAACAAAGTTATTCGCTTCATCAAAGCTTCATCAGCTTGACCCTAGTGTGAATAACTTTCGCA
CTGGACATGATTTCTTCGTCGATGCGTTCTTCAAGCATCGATGGTACAGTGGGAATCACAAGCGTGATGGTCCCTCATTGATTCAGGCATGGAACGCTTT
CATCCACAACGTTGGAGAGATTGGGCGTGATGCCTGGCTAGACAAGCTATTGCTAGCTCGAAATCGTTTTGAGAAACGGACCTATACCGGTGCACGTTTC
AAACTGCATCGGTTGTCAAGAGAGGCCGGGCTACCATGCCTCTCTTGGGGTGATGCGTGCCAAAGTTGTGTGAATTACTTGGCACGAGCTCCAAAGGAAG
CTTAATCGATGAATGACCCCTGGTGGAGGGTACGCGTCACTCAAGAGATGTACGAGGGAATAACTAATTTGAAATCACTCTACAAGCGCGCTGGGCGTTC
GTTTCCAGATGGGCCTTCTTCGGCATCGGATGCGCCTTGTCGTACTGCTCGACAAGGCCCAAAACATCAAGCAGCAGTTGAGAGCGAGGCTCCCAACTAT
CTGCCGAGGGTGGATACCCGCGCCACCGGACGAGGTAACTCGTCCGACGTCCTTTCTCATCGCGGTGGTTCAACAAGCGTTCCACGAGGAAGCGTTGGCC
ACCGCGCGCATCAATCAATAGATGAGTCGGAGGAGGAAACACGTTCTCAGACGGGTTTGCAGGCTCAATATGATACTGTGAGCCAGCTTGAGCGCGTAAC
GTGTGAGTTGCGCGAGGATCTCGAGCACGAGACGAGCAGACGTTTGGGTCTGGTCGACAATGTGACACGTCTCTCCTCGGAACGGGAGGGAGATCGATTG
GATTTTGCTTTTGCTCAGCTTGAGAACGAGCGGGCACAGCGTTCTCTTCGCGACGAGCTAGTAGAAGCTCGTCAGAATATCTCTCGGCTTCGCGGGGAGA
TATCCGAACTTCAGACTCGGGCTGATAGTCAGCACGGCGAGCACAAGTACCTCTTGGAGATGCTTGAGCGCAAGGGATTTCTTACCGGAAGAAGTCCCGT
ACTGGTGATAAGGCCTAAGGCGACCGACGTAGAACGTAGGATGCGTGCGCATCTTACATGGCACTTCAATCGTGTATGCGTTGCCTATGCGGCGCAGCAC
ACGAAATGGACCGATGAACTTGGGTAGTAGCTTGTTACTACCCACGTTAGTCACTATGTGTCGAGGTAAGTTTACCGTAAATAGTAGGACTAGGTCACCT
TCATTGAATGAAAGAACATTTGCCCTTCCATTCTTGTCTGCGTTTTTCTTTTGTCGGTCCACTACTTCTGCAATGGAATCTTGCACGAAACGGACAACCG
TTTCGCGAGCCAGTATGAATTCATCTGCTGACTTTGGCTGTAGTGCGCTTGGAGCGTACTGTGGCAAGATCATTGACCTGGTAGTAAGAGCATCCTCGCT
CTTACTTTCCTCTTCTTCACCGAAGTCGATGTGATCGACATCGGCGTCATACGTAGTGACCTCGTGGTCAGTACGTCATGAGTGAGAGCCGACTTGGTGT
TCGCTCGAATGAGTCCCTCCCCCCCTCAAACTAGAGTTACACTCTAAAAAGGTGGGTAGGCGTGGGTGGCGCAATCCATTCACGAAGAACGGTGTATGCG
TCGTCGATGCATGCATCGAGTTGTTGATGGCGAAATCTACCATTGGCTAGAATTCGCTCCAATTCGTAAACGAATGGACATAACCCCGAAGAATTTCCTC
AAGAACACGGTTTGCACGTTTTGTTTGACCATCTGTTTCAGGATGGTCAAAGGTCGACATCTGAAGGCGCGTTCTGAGTGTTTTGAACACGGATCGCCAG
AAATCCGCAGTGGACCGTGGGTCTCGATCAGAGACGAGTTCACGAGGCAACCCATGAAGACGAAAGATCTTGTCAATAGAGACACGAGCACATGCCGATG
CATTGATAGATTCAGGTACAGCAACCAAGTGTAACTTTTTGCTGAATCTATCAACGAACACAAGAATACCTGTATTCTTGTGTGGGTCTGCGGGGAATAC
AAAGACAAAGTCCATTGAGACTGATTCCCATCATTCTGCCGGAATGGGCAAGGGTTGCAACGGCGCACGAAGTGAAGTACCTGACTTCACTCGTTGGCAT
ACTTCGCATGCGCGGACGTACTTTCGCACGAACTGATACTGGCGGGGCCAGTAAAAGTCGCGACTAACTGTGAGATATGTCTTCTCTCGACCACGATGTC
CACCAGTAGGTGCATCGTGGTACTCATACATGATGCGCAGTCGCAAGTCACCATGGTCCGATACGACGACATGAGGCGTGTCGCCGGCAACGGCTGTATA
CTTCAGTAAGCCATTGTGGACTGTATATATATCCGTGGAGGATCGATATACTGGGGGCAACCTTTTAAGGGACTGACGGGATGGTTGCTAGAGATGATAT
ATCAAACGCACCATCGCTGGATCGTACGCCTTGCGTATGTCTTTGAATAAGGTTGATGACGGGACACTCAACGTCAACACCCCGACCGTGGTCGGACCAG
TGTCGGGTTGCGCAGCCCTTTCAAAATCGGGCCGGCGCGAAAGAGCATTAGCGACGACATTCAGTCGTCCTGGCTTATATCCCACGGAGAAGTTATACTC
CGCGAAGAACGACAGCCACCTTGTCATACGTTGCGAGAGGTGTGTACTGTTAACGGCCGTGCTTAAGGAAGCATGGTCCGTGTAAACGATGAAGGGTCTA
TCACGTAGCAGGTAGACCCTGAATTTCGCCAAAGCATGCTTCATGGTAAGTAGTTCCTTGTCATGGACTGGGTAGTTACGTTCAGCCGGTTGCATCTGAC
GTGACTGATAGCAGACGACACGCTCAGCACCGTCTGTGTCGTACTGCATTAGTGCACATCCGATGGCAAAATCACTTGCATCGCCGACCACATGAAATGG
TCTGTCTTGGTCTGCAACCGCCAAAACTGGCGAGCGTATCAAGCTTTGCTTGATACCTTCGAAGGAGCGCTGGAAATCAGCACTCCATGTCCACTTCTCG
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN