Description :
From Genome Similarity Track
Location :
contig_46:216450- 219469
Transcript NameFunction/comments
g8209.t1hypothetical protein

Sequence
3019 bases(100 bases per row)
CCCTCTCACTCGAGCGAATCGTGAAACCAGTCGGGAAATCCTTCGGGGGAAATTGGTGTACAGTTGTGACACGAAGTGTTCCTGGTTTTTCTGTGACGCA
CCGCCGTCGCGACTCTGGTCTAAACTTTCGAGCATGGATACTATTGGATGAAATGGAGAATGTGACTCGGCTGTACCCGTGCGACACGGGTGACGTATGG
AGTGCGACTGATTTATGGAAAGATCTTACGCCTAACCACAGATGGGCCCAACTGGCTGGAAGTGTGTATCCTGGATGTGTACAAATCCACGATTGCAAAC
CCGCATTATGTCCAGCCCCCGGACTTTCCCTTACGATGAGTGCCTAAAGCCTGGCGGAAAGTGCAGTTGAGAACGTATCTCAGATTGTACCTCATCTTGC
TGTGGTTCAGAGCGACTACTAAAGATACTGAACCAAGATCTACCAACACCCAAGTCGTGCGCTGGAAGCCCAAAGAGTCTGGATGTCAAGTACATCCTGA
ATCCTGACTCCAAAATCCTGACTCCAGAATACCAGAATCTTGACGGTTGACCACTGACTATTTGACTTCGAAGACAGTGGTACGTCATCAAGTGAAACGC
AATTGAACTACCGCCAAAGAACCCAACAGAACTGTCGAGTCGACACTTTTGAAGCTACGAAGACAATGTACCCAGACCATACTGAAGCGAAGACAATTTG
ACCCAAGCCATAGTGAAATCAAGATAAATCACCCAGAGCCGAGATCTAGAAAGAATTGATTTAAGGCTTACAGCCAACAACAGAGTTTGTTTTACCCCGT
ACTGCGCAAGTGAATTCGGCCAAGCCTGCCGACGGAAATCCGGAGGACCCGAGACTACGACCGCGATACAACAAGGGGCGCTGCGACCATTAAGGACGGG
TCGTCTGTGGCATCTCCACCTCATAACATCAAGTCCAGTTAGGTGGTGACCAGAGGCGCTCCGGCACCCTACCTATTTCATTCCTAGTTGGGTCACTAGC
GTGCTGGTGTTTGCCCATTTCATATTCCCTTGCTATTCGAGGTGACTGACTAGCAGTTGTCCCCCGAAGTGATAGTTTAACTGCTGTGTGTATCGACTGA
CTATAGTATTGATAGTTTCTCTCTTAATTGAGAGTGGTGCGCGTTTTATACGAGTGTTCAGACTGACTAGGTGTCTGAATTGTAAGACTCGAGTGAGCCT
AGCGAGTGCCACCGTCCAAGGGTCGATAAGAATAAGTGACGGCTATTTGTATTGTATATAACTCTGTATTTGTTGGCTATTGGTTTGGGGTGCATCTGGG
TAAAGGTGCATCCTGAATTTCCGATACTCTGGGTGTGAAATCCAGACTACACTCTGCCTTTCTGTCGTTGAGAGTGCATCCTGAAGTGGACGTACGCTCG
GCACAACTTCAAGGCCACAAGCTCGGTGAAGTGCCGTTTCGTCAAAGACAAACGAGCCGACAGGGATTCCGCAAGGTACCCACGCCACCAAGAACCCAAG
GTTCGCTTCGCGGTGAGATCTTGGATACTTGTTGACTCCTACAAGTCTTCCCCTTCAATCCTGGAGGAGGAATTCCTGGAGCGCGCTATACGAACCCCCC
TGGGCGGTAAACGTTTCATCGACCTCGCCACAGCTGGCAATCAGCCGGGCGAAGAGGGCTCGACTTTACGTGACGATCGGTTGAACAAACCGAATCTTGA
AACCGGCAAACGAATACGATTTCGATGTCACAAGCCACCGAGGTCACGGGGGCGATCGAAATAAACAGCAAAAGCCAAGAAATCCTCTCGCAACAAAACT
ATTGCAATGGCGGCAGACGATTCGGACATATTCGCTTTGAATATGAGTCTTGAAAATGTTCAAGTTGCTGTGAACGGTCAGTCCACTTACACCTCGTCAG
CAACGCTTCTTACCAGATTCAAGTTGTTCGAGCTAGCAAAAAAAAGCCAGGCCGCCGATTGCCCGCAAAATATCGGCGTTGCCGGCCTCGAAACTGCCGG
CTCCTATCAATGCGATCACGCGCATATTCCGCTCAGACCTCATTAAGAGATGTCATGGAAAAGTAGCAGCTCTACAGAAAAAAGAGAAAGATGCAGGACG
GCAAATCTGAGCCAAACAGCTAGTGTGGTGGGGGTTGTCGGTGTTGGCATCTATTCTACGTCAGCGCGAGGAGTCATGAAGAAATGGCAGAAGACTGCGG
CTTTGTAGACAAGGCAGTGAGTTGGATCGACACGATCGACTTGCCTTAACGACCCGAGGCTTTTCAAGTCGAGCCCGAACCTGATATAGCCCAGTCAACC
CCACTTCTTTCCTTTCAGGTAAACTTCCCTTGTCCTCTGTAGTTTTAGAAAATTTCTAATGTGGGATTTGCAGGCAGAAGCACTAGAGTTAGTTGAAAGA
ACTGCATTGGGTGACTGCACCGTGAACATGCTGATGTCGATGCTGTTTGCAGAGATGGCATATACCATCGAAATGGGCACATCGATCGCTGGAAACGTTT
TAAACGGCTTCATGCTGGCCCAGAGCATGCAGGCCGTTTTCGGTGGAGCGAAACACGAGAGATATTGATTCCTGTCATATGTGGCAGAAATCACTGGTGC
TCTATTATGATTGATCTTACACAGAAAGATGTGTGCATCCACGACCCGATGGTGTCAAGCTGTTCGTTCCCTTGCCAAAACCTTGATGGGTTTTGTTGTT
GCCAGAATTAGCGTCAAAGCAATATCGAGTCCGCCAGTATGTGAGCCAGCTCGGAGAGCAAATAGACAGCTACAACTGCGGCATATACATGCTGATAGCA
TTTGAACTGTTTGCTAGCGAAGAGAATATGAACTTGCTGAGTAAGAAGGAGTTGCAGTACTTGCGCTATCGGCACCTGTGAATGTGCATTTACATCCAGC
AATATATGTTTTCGATACATTCAAACTTTCTAAGTTTCTCTTTGTTTCGTAGCTAATTGTGGTAGCGCCGCACTTTGGCGCTTGGCCGTCTCAAAGCCTC
CAAAGATTATCCGGTATAC