Description :
From Genome Similarity Track
Location :
Scaffold_160:216432- 217795
Transcript NameFunction/comments
Aphin_H310_12331Amino Acid/Auxin Permease (AAAP) Family

Sequence
1363 bases(100 bases per row)
GTGCGGTTGGTGTACACAAACTCTTGGAATTCGGCGGGGCAGTGGGGGAACTTGATGGCGGGATTGGGGGTGTCGGGGGTAAACAACGACTTGCCCGACG
TGTACGAGATGTACACACTCAATGCAGAGCAAAGCACCAACACAAAAATGCACCACACGCGCTCGTAGACTGGCAGGGTCTTGCCAAACGTCTTGAGTGT
GAAGAGGACGGGCAAGATCATGCTTGTCATGGCCGTGGATGACGCACCGACGAAATCGAGGATGTCCATGAACTGGTCCTTCCACACGATCGCCAGCACG
ATGGTGATGCCGACCATGAAAACGCGCAGTACCATGGCCTTGAGGTAGTCGATGGAGCTGTTGTATGTCGGGGCAACCGACTCGGCGACACCGTCGGTTT
TGGGCGATTCCAACGTGACAAAGTCGTCCACTTTCTCGGCCTCGTCGTCCGAAACTTGGTGGAAGCCAAACAAGATGCGCTCAATGATGTAAAAGGTCGG
GAACACAATGACAGCGAATGCCACCGTGCAGTGCAGCTGCATGGAGAGGAAGGCGAGAACGATGCCGCCGCGGGATGCTTCGAAGCCGAGCTTTGTCCCC
GTGATCGCAAAGAGCAAGTTGCCCGGGATCTGGCACCCCACCGTGGACACACCCGTGATCGAAATGATGAGAAACAACACGGAACAAACGCCGAGCGTAA
ATACGATCACACGGGGCATGCGCTGCGGTTGCGTATGCTCTCGTTGGAGAGCCGGAATCACGACCCCCGCCGAGTACCCGAGCGACAGGTTGCCAAACAC
GGAAGTGACGCTGGCAAAGGTCGGAACTGGTGGCGGCGGCGCTAGACCTGCTGGGATCGGAGACATGTTGGACACGAGCACGTACAGCGCAACAACGTCC
GCGATGAGTGTCCCTGCCGCGCCGGCCGCCGCCACTCCCGCGCTCTCCTTCAGGCTCGGCATCAGGCACACAGGCATGAGCACGAGGCCCATCAGGATGA
TCCACGTCGTGTCGTCGTACGTGCCAGGGAAGAGCGTGGTGAGGAGCGTCCCGCTCAGCACGAGAAACGCAATCGGGACCATCCAGCACACGAGCAGCTG
CGTGACCACTGTAACATATCGACCGGGCTTGCCTAGACACCACTCACCCAGATCGCCGTACGTCTTGACCTTCTTGGGCGCTAGGAGCAGCACTTTGCTG
ATGCTGGCCGTCGTGTAAATGTTGATGGCCGCCATGAGTAGCACGGCTGCGGTCCCCCAAACAAAACCGGCACGGGCGTAGTTTCCAGGCATGCCGAGCG
TCCCGACCCCATACACGACACAGAACAAGTTGAACGACAATTTCAAGTCTTCGACGGTCAAGA