Description :
From Genome Similarity Track
Location :
Scaffold_42:21641- 34388
Transcript NameFunction/comments
Phyag_g1044hypothetical protein
Phyag_g1045hypothetical protein
Phyag_g1046hypothetical protein PHYSODRAFT_320441

Sequence
12747 bases(100 bases per row)
ACAAAGACACGAAGCGAGTAAGTGCCTCGCTTCCGTCGATCCGTTCACCCTCCCTCCGCTTCCTCGCGCTCGTGTCTGTGCCTCCTTCGAAATGGCCGAG
CCATCGACCAAACcccgcagcagcattcgTGGATTTCTGCACAGCCGcaagcagcgtcggcagcagcgccgcgccCAGAACCTCAGCCGCAGCCAGTACT
CGTCCGACGAGGAGTTCGGCGCGAGAGCGagcgccagcgtcaccagcagcttcacgtccgACTCCATTGCAGCCATCGCCGTAGCCATGGAGGGgatgct
caagaagcgcgcggCCAAAATGCCCGTCATGCACGACCGCTACTGCGTGGCCACGTGGGAAATGGACGGCGATGACGCCAAGTGCGTCATGCTGCGCAGC
TACAAGAACCGCAAGAGCTACGACGCCCATCCGGAGAAGCCCACGAGCGTGCACCAGCTCAAGTGCATCAGCGACTGGGACGGCAAGACGGGCTTCCACC
GGTATCAACATGCCTTCACGATGGAAACGAGAgacaagaagctcttccagTGTGTGGCGCCTTGTGCAGCCGATAAGGACAAGTGGGTGGAGCTCATGGC
CGTCCAGTCGGCCTTTAATGGCGGAAGAGATATGCGGTTAGGCAGCGTAGGAAGCCTCGTGCCCTTAAGGCGCACAGAGAGTGTGCAATCTGCGGCGGAC
AGCGGCAAACCGAGAGCCTACACGAGcgcgtcgatggagaaggaagaggaagcggcggcggagCACTCGACGGACTCAGAGGGGCAGGGCCAATTTCCTG
GTCATGACGGGCTGTTCAGGACCACGTCGGGCgcgtcgacgagctccatGGAGCTGCCGAACGGGGACAAGAACGAACCCGCTGACTGGGGCATGTACGG
AGACGCTAATGGGGAGAGCAAGTCTTCCAAGTACGAGGTCATGAATGACGCTAAACCGGTGATGCTCTTCGAtaaggagctgctgaaggcaaGGGGGGAG
AGCAAGACGTTGGCGAGTGACAAGTTTTTGtttgaagaaggaggcaaGAGTAGATTTGGTGCGGTGGTTGTGAAAGGACAAGAGGagagagacgacgacg
acgatgatgttgAGTTGATCGACGAGgagtttgctgctcgtgaagcgcagaaggagaacgagaagaacatgaAGCGGCGAgcgcagaagctcgagtCGAA
CCGTGATCTGTATGCTGAGATGGCTGCGGCAAGGCTTGCCGATATGCGCAAGGACGCACGTCACCCGAAGAAGAGTCACAGTCACAGTCGTAGCCACAGT
CGCCATTCAGAGGACAGTGAAGTGGAACAGCACGATGAAGATCAGTCGTTGGTGGTTGAAGGAGAGGTGGGCGAAGTtgccgaggtggaggagatgcatC
TGCGACACAGCAGTCGAAGTAGCCGTAGTCGCCGAAGCTCCAAAAgccacaagaagagcttcgtGAGCAGCGAGAATGCCAACAGTGTTAACGGCGGATA
CGCTagcggcgacgatgaaggggatctggaggaagaagaggtgGAGCCGGAATCGgtcgctgctcctgctgctaTGACTGAAGCGGAGAGCGCGGCGGCc
gaagagctgcacgagctgaagaagaaatacAAAGCCGAGCGTCGCGCTAAGAAGCGTctgatgaaggagaaggaggaagaggagcgCACTGCTCTGGAGG
CTGCTGAGCTTGCTCGCGCCCATCGTGAAGAACAGCGTGCTCGTGAGGAGGCCAAGGCTcgcgaggagcaggagacgcgcgacaagaaggagcgtcgcga
gatgaaggagaagctgaaacgcgagaaggccaagcagcgccaagctgaagctgatcTCCGTAAActggtggagcagaagcaagcggaggaggagcgtcGT
GAGCGCGAGCAcagggagaagaaggaaagAAAGGACAGGGAaaagaaggacaagaagaagtccaAAAAGAAAGAGAAGTACACGTCGCCTGCCGAGCGCA
TCCAGAAAAAGGAGGAGCGCGACGCTGAACGTGCTGCAGagtccgctgctgccgctgaagctgaagctgaggTCTCGAACGCTCTGGTTGTCGTGGAAAA
GCCGGCGGAACCGGAACCAGCTCAGCAGCCGCTTGCGGCTCCGGCGCCCGCTCCGACGCCGGCAACCACGTCGACTTCCTCATCCGTCCAGACCAATGCT
GTCCCGACACAACAAGTTGtagctccacctcctgtCGTGATACAACAAGCGCCAGCTCCCGTACCTGTCGCgacacctgctgcagctcctgcctctgcgc
ctgctgctgttgctcctgctcctgctccagttaacgcagctccagcagtccAAGCCCAGGCGATGCCAATGTACCAGTTCGTTCCGCCGCCGTTCGTGCC
CACTTacccgccgccgccgcagagTATGCCTGCGTACGGTCTGGCGGCCACCTTTGGTGCTTATCCTCCGATGTATCCTGCTCCGTACAGCTATGGCATG
CCTCCGCAACCCCCGTTCGTGCGTCCGAACATGGGGTTTATGGCTGAACTGAGCGCGATGGGGTCGTTCGGTAAGGCTGCTGGCCCGGCGCCGGCACCTT
CCATCCAGGACGCCGCGGAGCCCATGATCGGCCCGCAGCTCCCGACCCCAGaagagcgcgctgctgcctcctcgACAGGCCCAAGCGCCTCTTTCTctgc
accgccgccgccgccgccgtcagcGGACAAGCCAAGCGCAAAATTGACCAACCTGCCCGAGCTCCCGGACGTGGTCGAGTTTTAGGACATGTGTGAGTTG
CTCTCGTGCACCCGAGAGACTGGATTAACTTAATTGCAATCGCGTTTTGCCATTCAACGCGGTCCAGCTCCCTTCCGCGATGCCGTGCAGACAGCAAGGT
ACGTTCTGCTGTGGAGATTAACCGTGTGTACATGTAGGTTTCGTGATGGACCGATAGTTCCCTATAAATATTGAGTCGGAGGCATTAGCGAGCGTCGGAC
GCGGCCTGCATCGTAACGGGGCTGCGTATTTTCGCGTGGTGGGACTCACTTCATCATGCGCGTGATGCCGGCTCTGTCGGTGCCGAGCCGCAGCCGCCGG
CGGTCGTCGGTAACCCGATCGCCGAGTCGAATGAAGATGTTATTGCTGCGCCAACGGTTAGGTGCGGGCTCGTCGGAGCTTCTGATGGCAGAGAACCGTA
ATGCGTTCGACCCGAGCTCGCGTTTCATCCGCATGTGCCAACAGCTTCGTCTCGCTGCGATCCTCTTGGAGCTCGTGTCAATCCCGTTCCTGGCGGCGTT
CCATCCCGAGGCCACGCGCTCTCAACTCATCGGCGTGTACGTGTGTGAACTTCTTTTTTGTGCAGATATCTACGTGCAGCTCAACACCGGGTACTACGAG
AATGGCAACGTGCTGCGGGATGCACGTAAAGCGCGACGGAAGTATCTGTCATCGCCCGGATTCCTGGCAGATTTATTGGCGCTTGTTCCGTTATCACTCG
TGCTACCGGAAAACACGACCGGATCACGgtcgatggcgttgctggaaaTGCACAAACTCGTGCGGATGTGGCGACTACCAGCACTCACGTCGAATCTTGA
TGACCTCTACGCAAGGCACTTTGCGGCGCTCAAGCTCACGAAAGTACTGGGGTTCACACTGCTATTGACGCATTTTGTGGCTTGTGGACGCTTTAGCTTT
GGTTATGACGATCCTTCTACAGGTGATGAACCAAACGATTGGCTGCCTCATGCTCCTCATGAAGGGCATCACACTACTAGAAGGCAGTACCTAATGTCGC
TCTTTTGGGCGTTCGGGCTTCTCACTGGAGGCTTCGAGGGGGAACTACCGCGCCACAACGCCGAGTTCGCATTTACCATCGCTGTTGGACTATGCGGTTT
TACACTGTTCACTTCACTGTGCGCGACCTTTTTTCTTCTCTCCAAGTGCGAAAGCGGCGACGCGGAGCTGGCAGAAGCGCGCGTACATCAGTTCCAGCAC
ATTTTGGCATTCCACCGGGTCCCAGCTCAACTCCAGGCACAAGCAGTCGACTATCTCCAGCGCTATCACACTCAAACCGAAGCAAATGaacgtgaagctg
cacgaagaCTTTGTTCGTCCATTTCAGTGGACATTCAAGTGGAACTGCTCGAAGCCACCGTCGCGTTGGTGCCTGTGTTTGCTGGATGCGACTCACTGTT
TATTCGAGCTGTGGCGCGCCTTCTGGAACTGGTTGCACTTCCGGCTCGGGTTGCTCTCTTTCGTGCTGGTGATCATGGAGATGCCATGTACATTGTGCAT
ACTGGCGTTCTGCATACAGTTGTAGGAGGCGTGAAAGTGCGTGAGCTGCGAAAAGGGAATTTTGTCGGGGAAGTTGCAGTCTTTGCTCGACAGCCACGCT
CTGCAACTGTGATCACTGCTACGTATTGCACGTTGTATCGGTTATCGCGCATCCACGCTgacaagctgctcgaggGCTACCCACAGTACGCTAAAGTGAT
CAACCGCACTGTGGACGAAATGCTTCAgaaaaacagcagcactgaTGTGGAGGAGATATCCAACATCCCGCAAGAAGAAtcggaggccaagaagaatACG
GGACTATCGTTGGTGCAACTTGTCCACCTGAAGAGACTTGTGCGGGCGCGCGCTCTTGCAAATAAAGTTGGCGTGTCTGAGGATCCTACAGATTCGACGA
AGGCtgatgaagtggtgatgTTCAAGGAGGACAAAACAGTGGAGCCAACTATTCCTCAACCACCTGCTTATTGTCCGCCACCAGCAAGGAAAATCTCGCG
GGTGCATTCTGAAAATGCCAAGAGCCCAAGGCACTCATCACCAatgccaccaccatcgcAACACTTGCATAGCGACACCTTCTACAGTGACAGCCGCTTG
TCGGCACGGAAACGATCGAAAAGTGCGTCACACCTGCTTAAGATATTCCCTGCTACATGCACCACCCAAGCACAACCTGTCATCACATCTacgccatctc
cagcatcaccgaGACGGGCTAGCCAACGCTTATCATTTCTCGCAAACATAACCCGGATCACAGTGCTTCGCGATAACTTTTTTCACGATAACACTGTTAA
ACCAGCCGACGCTATCCAGGGTTTCTACGAACAGTTCGCACACCTCACAACAACTTCCTCTGCTTCGCGTCAGCGGTGGTGGCACCGAGTTTTGATGAGG
CGTGGATTAGATGCCGAGACGAACTGGCGGATGGCGTGGATTGCTCTGGTTGCTGGTGTGATCTGCTACAATTGGGTTCTAATCCCTCTCCTCCTAGCGT
TTTCGATGTTGGACGAACTCTGGTCAAGTTGGTACATCATCACGTTAAACGTTCTTGCCGACATCGTGCTTTGGATCGACATATACTGCAGTTTGCACCT
GTCGTTCTCCGTGAACTCCGAAAAGATTGTAGAGCCGAAGCGCAGTGCTGAGCGCTACCTCTCAAGTGGGAGGTTCATTCTCGATCTATGGTGCGCGTGG
CCGTATTGGATCTTTTCACCAAGCAAATTCACGTACCCTGCGTTACGCATTCCAAAGCTAATCGGTGGATACCGGCTGCCTGGCCTTGTTAGGGAAGTCG
AGGCCTATTTTCGCCTCAACAGCAAGCACAAACTCATGCTACTCGGAGTGTTGTTTCTCATGCTGTACCATATCGTTGCGTGTTTGTATTTCAGCACAAC
ATATCTTGATGGCTACAGCACTGGTGATGACAAATGGCTTCCGTCAGACGATGTGTACCTTCGTCGAATAAATGCAACGCATTTTGAAACGATTTCTGGT
ATCATCCTCGATGCTGACAGCACGAAAGTCCAAGAGATGAGAGCTGAGCAATATTTTCGATCATTATACTACGCTGCAAACGTCCTGGCAGCCGTTGGAC
GTACGATTGAACCTGCAAGCGACACGGAATATGGGGCAGCACTGGTTTTCATGCTGAGCGGGTTTTTCATCACTGCTATCGTCGTCGACCACGTGCAAAA
GGGTTTCACAGCGTCGGCTCTTGAGCAAAAAGAGTTCTTCGCAGCGCGCGCTAGGTTCCAGCGTTTTCTCAAGCGACAAAATGCCCCACTACCTATTCAT
CAACGAGTGAACTCATTTCTGGATTTCTGGTGGTCTGCTCACCGCGGTGCAATTATTGATGAGTTACTGGAGGACCTCCCTGCTGCTATCAAGCGCGACG
TCATTCGAAGTATTTGTACGCCAGCAATGGATTCATTAGAGCTACTTTGCACCACCGCAACGACCTCGACAACTCCTAAAAGAGAGGAAGAGCTAGAACC
TTCAGTGACAACCATACTGGAACAGGTGGAAGAGATTTTCCTGGACAACCTCAAGTTTGTGCTCTACGGCCAGGGTGAGATAATTTACCGTCGCGGTGAT
TACGCTTCTGGTCTCTTCTTTCTGCTGGAAGGCAAAGTCTCGGTTGTGCTTGACGGCGGAGTGGCTCGACACGTTCCCCTGGGCGGATTTTTCGGAACTG
CGGCACTACAGTCGACGAGAAACAGTCGTGATAGGCGTGAGAGTAAACGACGTTCTACTGTAATGCCATCGGTGAATATTGGCTATACCGAACGTGTGAC
GGCTGTGAGTGGTTGTATTGTGGTATATGTTTCACGAGAACACCTACGAGCGATGCAGAATATTTTCCCCACTCTGCCAGAATGCTTGCAAAAGTTGGAG
CATCGTTTACATGATACACGTGTAGTGCGGTCGGCTGACTTACGGTCTTTGCAACCACGGGTTGGACTGGGTGCTATCGGTTTGAATAACCCAACCATGC
GGTTAGCACTACGGCGTAAACAAGTGACCGGACTAGTGCAATTACTtgcgaagaacttggagtGGTGGCAACGGGGCGTAGCGGTGAACCCGGACTGGCC
ATTCGTGGGCATGTGGGAGGCGACAATGCTACTGACATCAACAGTTCAAGGTGCCTTGGTGATGTTTTATGTGTGCTTCGGCGCGAATGACAGCTCGGGT
GGACGCACATTTGCCGATGCGATCATGGTTGCGTTTGAACTACTTTTCGTCCTGGATGTCTACTTACACTTTCGACTGGGATTTTACGAATATGGCAACA
AGATTATGGACCTTGCAGTGATCCAACGTCGTTACGTGCGCTCCGTGCGATTCGCTATCGATATAGCAGCTCTGGTGCCGTTTTATATCGTGAATTGGAT
GTTTCCAACGAGAAACTTGGAGATCTTGAATGTCAACAAAATGCTGAGGTACTTCAAAGGTTCTAGTCAATTTCAAACCCTCGAGACCAAGTACGTTAAG
CTGACGATGGAGCTGAGACTTCTTAAGCTCGTGTACTATTCGTTTCTTGCCTCGCACATGTTTGGCTGCGTCTGGTTTGACTTCGCGGCTCACAAGTCTG
GAGTACATATTGTGTTGAGCGGTCCTACTGACACTTCAACGCCTTCCTTCGGAGTTGGTGAGTGGGGGCCTTACGAATCATTAGAATCAGCTGCACGAGG
TCTTCAGTACCTTGCGTCTATCTTCTGGTCCTACGGCCTCATGTCGAATTCGAGTCCCGGTGAACTACCCAAGACTGTCGGAGAATGCATCTTCAGTGTT
TTTACGATGACGGTGGGGTTCTTTCTGTTTGCGTACGTTGTGGGCCATATTTCGGATGTTATTGAGCTCCAAGACTCCGAAAATCGGCACTTTGTGGCCA
AACTAAGCTCTTTGCGGCAGCTTTTGCGTCACTTTGACCTGCCGCCGAGCGTTGAAGAGAAGTTCAAAAagtacttcttcttcaaacgtTTTCATTCAAT
CACTCAAgagcacgtgctggagcgTGTACTACCACCGTCATTGGTTGTAGATATGCGCATGTTCCAATTGCAACCTATGATCGTGAAGGTGGCGTTCCTT
GTCGGTATGGAGGACTCAGTCACGCGTATGCTCGTGTCGCTGTTCACGCAAGTTTTGTTCGTCAAGGATGAATTTATTTGCCActttggtgaagaaggca
gcgagATGTTTTTCATCTACACAGGTGTGCTGGACATCTACATTCCGTTTCTAACACCGACAACACCTTCATCGCCAGGTGGTTCAGTTGCCTTCCCGAC
GACGTCTGCGGGTACGCGTGTGAGTTTGAGCGGGCTACGCAAAGTAAATGAGATCACGGCTGGAAGTTACTTTGGCGAGGCAGCTCTATTCACAAACACA
CCACGAAATGCATTCGTGAAAGCCAACACGTCGTGCATATTGTACAAACTCTCTCGACATTCGCTCGAGTTGGTCTTTGTGCGGTATCCCGAATGGCAGC
AAAAGGTGTTGCGTATTGtcaagatccagcagcagcagcaacgacttcAGCGTCTTGCGTATGAAGCTCAGGCTCCTGATACTGGAGGTGGAGGGCGTCG
TCGTGGGCTTCAGCATAGAGGATCACGCATTGACTTTGTCAATGCAAGGGCGGAGAACATCGAGCAAGTACTTCTTAGCCACCGAAGAGGGTCTCAGTTA
TCGGAGAACGCACCTCGCCGGCTACTCATTCGACGATTAAAGTCTTGGGTGATTCAGCAGTGGAAAAATCATCGTGCAGTTGTCGCGATGGTGCGCTGGA
TGACACCAATATGGATTTCTTTGCAGGCCATTGGGAACCAGATTGCCCATGGAGCAGAGATCCAAAGTGCGTTCTACCTGCAATGGATGCGTTTGGTATC
CATTTGCACAGTCTACGTGGCTGTGATGGTACCATATCGCCTTACCTACGATTCACTTGACCGATGGAATTTAATTCCAGTTTGTCTTCGAGTGTTCGAA
GCTTTGTGCGAAGTTGTTTTCTGGCTCGACATTTGGTTTCAATTTCATATGCGCAAGAACCAGGCAGCTATGGAACTGTACGAACAAGATCAGCTCGTAG
GATACAAACGTGAACGgcttgcgctcgatctcGCTGCTACCTTCCCACTGGACCACTTCGTGGCAAGCTTCTCGAATGGATGGGACCAACTGTTGTTGAA
TAAGTGGTTGCGCCTAAATCGATGCCTGAAAGTTGCCAATCTCGTGTATTACCGGAATGAAATTACGCGCCGCAGTGTGTCGTTCGAGGTGAATCGTGCG
CAGACGCTCTGGTTGTTGTATCTCCTGGCCATGTTTTGGACGTCCTGCGCCTACTTCGCAGTGTCTATCTACGATGGCTTTGGTACCGAGTGGCAAAACT
GGCTGCCATCGGTCATCCTTGATTCCGACGACCCATCTTCAAGTCTAGTGATGCTGAGGCTCTTCCGAGGTTTAGCCTTTGCAGTCACTGCGTTTGTGAA
AAAAAGCAGGACCTTTGTGCCTGCATCACAGCTTAACTTTGCGTTTACTCTGGTCATTTCCTTCATCGGCCAGCTTATCATGGCGCTCATGATCGCGGAA
ATGGCCAACGTGTTTTTGCTGTACATCGACAACGAGGTGCAGTTCCGTAAGCACCATCTCATTGTCGAACGTTCGCTTGCAAGATGGAAAGTCAGTACAG
CGTTAAAGCGTCGTGCCGATAACTTCTTGACATCTTGGTGGTCTTCTCATGCAGGTGTCGACTACCAACTAATCTTTGAAGACCTCCCTGCTAGTGTACG
CACGGAGGGTATAATGGCCATTGCAAAGCAACCCCTCAGTTTGTTCGTTCACCGCGTGTTTCGGCCACTGCTTCGTGAccaaggtggagctggagctgga
gctgaaggtgATGGTGAAAGCAAGGAAATACCTGAACAAGTCTACGGTGATCCATTCCATCTTGGAAACCTCACCTATGCCATTGCTAAGTGTCTGCGGT
TTGAAGGATATCCACGAGGGGAAGGCATCATTGTGGAAGGCAGCGTGTGCAAGGCCATGTATTTTGTTGTCCGTGGCTACCTCTTGTCGAAGAGTTTATC
CAACTCCGAGATGTACCCCGCTAGCCGCTACCGAGGTGGGGATTATTTCGGTGAATGTGGTCTACTCGGACACTCCGTCAGTCTCATGACGGTCACTACC
ATCCGCGCTTGCGACCTGTTCGTATTGAACTCAGACCATCTTCGTCAGGTGCTGCAGTCTCACCCATATTTTAGTCTGATCCTTGCTACTgctcaactcg
ctgcaagtcagaacaagaagaagaccactGCTCAGTTTGTGGCCGAGTGGTTCCGTAGcaacgacgagatggaggatATTGAAAGCAGTGGCAACAGCGA
AGATGACAgtgatgcagatgacgatgacagtgaagacgaagatgaaggtgaaaAGGACCAAGTGTCTGCCATGGCCAGTCAAaacgacagctccatgaGC
GAAGACGTAAGACTACGGCGTGGGAGTCAACTACTCAAGCGAGAATTGCGAGGGGCTTCCCGAGAAACTATGGATACGTGGGCGGAAtcgttcgagctct
tcatgGAGATGCTTGTTCCGAAAGGCAGTATGGGCCCCACAGAAGttgcaaaagctgctgcagttcgtaGGAAAAGCTCGCTTCGCTCATAAAAAAAAGT
TTTGAATAAATAGCTGAATTCGCTTTcactcgtccacctccatcatACTTTCAAGGCGCCTGAGGATCTTGGTAAGGTTGTTGAGCTTCGTCTCGAGCCG
TTGTTCTGTTTCGATAAGGCGTTCCTGGAAACTCTCCTGCATGTCGAGCAATCGAAGCAGTAGCTCGTTATCAGGCATCACTAGATGAGCAGCGCTGCTA
GACTGTGTGGGAGGCGACAATCCAGCCGTGTCAGCACTAGGCCCACTTTGTTGTTCGggtgcagcatcgacgactgCCGTTGCATTAGCATCAGTGAGCT
TTGAGTCCGAGGCATCCTTCATAATTTTGCCTAGCAGCCGAAAGGATCCTGTTAAGCTTGACTTCCTCCGGCTGCTGATACGAGAGACCCTGTTAGGCAT
AGTCTCTAGTTCTGTTAAGCTTGACCTCCTGCTGTTGGTATGAGAGACTTTGCTTTGCAGTAGTAACTCGGTTTGCGACTGAAGAACGACAGAATTTGAC
CGACGTCTTGAAATTGTTGGTGAGCGGTGCTGGGGCAGCACGACACCAGGCACAACCAACTGGTTCATGAATGCTCGATTCTGTAAAATTTCGAGATCGT
TGCGAAACTTGGCAAGCTCGTCATCCTCGAGCATTCCGCTGTTGTCCGTATCATACACGGCGATAACGTCGTCAATGTCGAGATGGATCCCTTCAGTGAC
TGCGTGAAAGCGCTCCAAAATGGCTTCGATCTCGTTGCGACAAAGCATGCGCTTTCCCTTGAGGTAGTCGACGTTGCTCTTCATGGTTTGGTGCATGACA
GACTTCATGACTTTTTGAAAGTTTGTACCAATGACCGTGATAggcagcgccagcacaaGCATGCCCGTGAGAACTGTGACGCATCCGACAACCTTTCCGT
CCCAAGTAACTGGAGTCATGTCGCCGTAGCCCACAGTGGACATCGTCACGATGCACCACCAAAAAGAAGTCGCGATGCCTTGGTATGGATTCGGATCCAC
GCACACACAGGCGTCCGACGCTGACACAGATGCAACggctgccgctgcagagATCGAATACACGACGTCGGTGGTATTCACAACCCCCGAGGACTCAATG
TCACACTTCCCCATccaaccaccagcacgacAACCGTCATTGGTAAGCTCGGCAAAGTAAATGGCCGACGAGAAAATAATCATGGCGATCGACATGAGGA
ATATTAGCATCGTGAGAGGCTTGATGCTGATCGAGATTGCCTGTGTGAAGACCTGAATCGCGGACGAGTAGCGAGACATCTTCAAGACACGCGCTACACG
CGTCAGTCGTACAATTCTAATGGCACCAAAGgatccagctccatccacAGCTAAAAGCGACTCCAGGTAGTACGGAAAGACAGCAGAAAAATCGACCCAG
TTCGAGTAGTCTAAACAGGTGAACAAAGCAAAAAACAGGTTAGTACGAACAACTGCGTACAACCACAGCAGGAATTTGAGGCCTACCACGGAGGAAACGG
ATTTTGCTCGGACACACGAGTAAGCGACTGACAAGTTCGAAAGAGAAGACCCCGGCACAAACTGCTTCCATCCGAGTGAGATCGGTCATGTAAGGGTCGA
ACACTGCCTCCGTTTCAGCGACGAATACAAATGTAGATAAGACAACAAAACCATAAATGCCCAGTGAGTAGTAGTACGCCGGAATTGACGACTGCGGGTC
CTCAAAAAACAACCAGGCCGCTTGCATATAGCcctcgtgctcttcaccgtctccgGCCATCGATCCCACCTCAGTTTTCGACTCTTGTCGCAAGATAACC
TTTTTCGATCCATTCTTCTTGCCAGGACTTGGCAACTGGAGGCTACTACCTTTCTCTGGTGACTTTACCGAGCTCTCCTCTGGTGCCGGTGTCACTGATG
ATACTCGGTTGCTTCGTTGCTTTGGTAGAGTTTTACTTGTCTTCGGCCGCGAGAACGATGGAAAAGGGTTTTGAACACTGAATAGACTTGAGGTGTTGAG
TGCCGAAGTCCGTTTGGCTTCGCGTTCAATCACCTTCGAAAGCTTCAGAGCTGTCTCTGATAGTTCCATGGAGCCTCGAGAGCCTCGCATGATGATTTCT
GCAGCCCCAGTGGATACCACCAAAGAGATCGAGAGAGTCAAGGGCCCCTGCTGCCACCTTGAGTGAGGTCCACTTCACTCACAACCTTTACCTGTCACAC
AGGAAAACACGCACAAGCAGTTAGTCCACTAAAAATATGGCGATGGT