Description :
From Genome Similarity Track
Location :
Scaffold_144:2164- 4931
Transcript NameFunction/comments
Hyaar_Emoy2811023ribonuclease H

Sequence
2767 bases(100 bases per row)
CCTACATAGCGCTGCACGCTCCGGTACAATTCTATCCAATGGAAATTCGTCCTAATCCGTTGGTATGTGCGGTCTAATCCTTGATGTCCGTTCCCAAACT
AGTATGGTAATGATGTAAGACATCTCGTTGCAACAACTCGGGAATTGCCAGACGAACCGACTTACCACGGTCTTCGCTTTTTGCTGCTGACTTAGGACAG
AAAAGTAACAATCCACTTTGATCGACTTCGTTGTCCGGTGCGATTAGGGCGCAAATATTTTTCTATCTGGTATTCAGCATGTCTATATTCCCGATCAGAT
ACGTCTTCAAGTTAGATAACCAACTATCCTCATCTAGCGCCTGATTTACACGCTCAATACGGACCTGTTGTACAATTTCTTCTTGAAAAAATGTCGGGGA
ACATCGTCTTCGCGTCTTTGACCGCGTGATCGCAGCTACCTTGACTGGAAGGCAGGCTTGTCTCGGTATCGTTAACTCATTCAACTGATTAAGCGTCATG
AGATTCTTTCGTTCCTGGTCTCATACCACGGCGCCCCCCCCTTCTCCTGCGGTAGAGCTTCTCTCGCTAGCCGATCAGCACTCTCGTTCCAGTCCCGTTT
CATATGTAGAAATTCGTGCTTTGGCCGTGATCGGAGTTTCTCCATTGCCCTATGCCGCAGCAATTGCAAACCTGGTGCCTCACAATCAATTTCACCCCGC
ATCTGTCTTATCACCAAGTTCGAGTCACCACAAAAAATCACCCGCCCCTTAGTCTGATCAGCCAGTAAATCAAACCAAGCAATAGTCCACGGTATTCCGC
TTCATTTATTGTCAAATTCTCTGCAACTCGGAAATAGCAGCCGCGATTATCCACTCAGTTAAGTTCAACATTATCGCACTGTAGGTGCCGCCCTTCTGAT
TAACCCTAGCCGATCCATCGAAACTGACCATTAGGAGATTTTCGTCGGCTTCGACCGTGGGTGGTGGCATGCTTATGGTTTGCCGTGGCTGTTTTCTTGG
AGCAATCGCTATCCGTACTTCACCTACGTCTTTGAGGGGTGTCACACTTACGGACAGCGTACCCAGCATTTTGCCTTCGCCTTTTTCACATCGCCGGATC
TCAATCGTCCAGCTTGAATATACCGCATACCATTTCCCTAATCTTCCGGTGAGACCAGACGACTGCAATAGCCAAACCCAACGTCGAATATCTCGTAAGT
AGTATAATCTCTCGTTAAACCAACATCGTATAACAGATGTCTAATATTCGGAGGAGAGTTAGCACCTCTTTCTCGACCATTCCAGAATTGACTTCGTTGA
TCTTCAGCGTGCGCTAGAAAAGATGACTGGCCAATATATACCGTCGTATTCCTAGAGTAATTCAGCTGATACCGCCCACTTACTGGTGCATACCACAATC
ACAGGCGATCGGTCTCGATCGACATGTCTTCAGATCGCGGTTTTATTAATTTTAGCCTTTAACAGAGTAAAATCTATTACCACTTTCTTCCATCATCGAC
TTCGCTTTCCGAAGTCCGGATCGCCCCCAATTTTTTGGTCCAGATCGCAACCTGTATTTGAGCCAGGAATGTGTTCGGACCCATCTCGTGAATAGCGATC
GGGTTCGGTGTCTGATACAGATACCTGAACATCTTTGTCTCGGCTGATCTCATAAATAAGCTTCCCGCAGCTCATAGATAACAGATGCATATATCGCAAA
GTCTTCAATGAAGCGACTGTGGTAATTTAGGCTTCCCAAGACTGACTGCATCGATCGCAGAGTTCGAGGAAAGGAAATATTCACAATTGAATCGAAATAC
TTGGGGTGGGCTTCCAACCCCTCAGGCGAAACTAGATAGCCAATGTATTCGACCTTGCGACGCCCCCGAAACGTTTGGCTACACTGATCGATAAGTTTCA
TCTATCACACACCTCTAACAGCTGTCCCACCCTTTCATATAGGAAAGTCCATGACGTAGCAGGTATCAAGATGTCGTCGATATACGATCTTCGACCTTGG
ACCGACGGTCTTGGGTACGTCCTAACTCGAGTAGAACACCTTCGTTGGCGTCGACGAAGGTGTTCTACTCGAGTTAGGTTTGGGCCGATCCTCAGATGCC
CATATAGTGCATTGTCGATCAGTCACTGGTAGATCTGGGGAGTATTCTTCAATCCAAAATGCATCCGTAACCATTCAAACAAACCCAACGACGTGACGAA
AGCGGAAGTAGCTTTTTCTCGTTCTGTCATCTCCATCACCCAAAATCCACTCGTAATATCCAAAGAGCAATACCACATCGCTTTATCCAGTTCTTGCAGC
AATTCGCTAACCAGTGGTATGGGTATATCATCAATCTTGTCAAATGGTTCACCTTTCTGTAAAAATGCATAGTCGTATATCTTCCCCATTTTTCTTGATG
ATCACCACGATAGGGGAAGCCCAAGGTGAGGTGAATGGTTAGATGATCTTGGACGATCGTAGTCCCTTGATCAGATCTGCCATTTTATCTTTCGATATTT
GGGTGCCACCGGCAGTACTCTCTGCGCGACCGGTTTAGTACTTTTGACATCAATATCGCATACCGCTCAACGCGCAGCTGGGGGCAGATCATTAACCTTG
TCTATGAGTAAATGACGTTTATTCCAGATGAGTTGCCGCAACTTCTCTTGATCATTTGTCAGTGGTATACCTGGATCGCCAACCTGAATGTCTTCGATAG
CCACCTCTACCGTGGGAGCGACTATTTCTGGCAAGATTGCCGTATGTTGGTCCACGTCTTCGGCGAA