Description :
From Genome Similarity Track
Location :
Scaffold_471:2164- 3560
Transcript NameFunction/comments
Phyta_totarag8588hypothetical protein

Sequence
1396 bases(100 bases per row)
TCCTCACTATCAGAAACTTCCATGGAGCTCTCTGATTTGACTGGTCGGAGCTTGGCCCCATTCTGCACCTCTGGAGTTCCATCTCCGCTAGCAACTCGTA
CAGCCTCGCTAGAGCCCTGGATAgaggcagccagcgccaTTCGTTCCTCATTCTTAATCTCCAAAGACTGGCGCACCTGAAAATCTCGCTCGCGGCGCTT
TCGTAACGCGTCAGACCGCATTTTCTGCTCTGACTGACGACGCTTCACAAAGCTCTGAATGGGCGGAGGAGCTAGAAAGCTAGAACGCGTGCGTgacttc
ttctcgatacGATAGACAGCATTCTGCACCCGCACTTGCTCATCGAACAACAGCTCATCGCTGTCGAAGAACGTCTTGTATCGCTTAGCAATTATCAGCA
GCATGTCCGAAGCTCCATCGCtgtccttctgctcgtctGCCTTGTCAGCCCATGTCAACGCTCGCTCGCGCTCGGATTCAATGGCGCTCCAATCGACTGC
AGAGACAACAGCCACCGCCTGAGCTTCTTTTTTGTCGGCGCTTGACTCCTCGTCACCGCTGTCACTGTTGTCTGAAACCAGGGAACTACCCCCGACGgct
tggagctgcttgcgaaTTTTAGTGTAATTCGGAAGGTCTTCATACTTGAGTGACTGTAGATATtccatcatctccagcaactgcacgGCACCTGGAAGAC
CCTCTACCAACAAACTTGGATTCAGTTCTGTGTAGTGTTCTTTGAGACTCAGCACAGTCTGGCGGTTTTTCAGCTGTGCGTCAGCAGCCCACGGCAACTC
GCCGCGCATAAAATCCATAACGAGATAGAACCACGACCACAGATCGTCCTTCGGACCCAACTCTTGTCGACGGTGCGAGCTCAGCGATGCATACATGGAA
GTGCCTCGAAACTCAGCAACAGAACGAGGCTGCAACACCTGTCGATCTTCACCAAGGTGCTGTCTCGACAGTCCAAAGTCAATGATGTAGTACCGCGGAT
TCCTCAGTGGATTACGATCCGGGATAGCGCTCAGCGCGAAGTTCGACGCCTTGATATCGCGATGCACATATCCATGTCGATGGAACGCCTCAATACagtc
cagcatctccagtcCGACCGAAACAGATTTGGCCAGCGGCACCCCATGGATCGAGTCGGGCGACATTCTCAGCATCGACATGCTCTCCCCTAACAACTCC
ATCACCAATACTGTGCTGTCTCCATGCTTGCCATGGTAATAGTATCTGCACACGTAGGGACAGTCCTGCAGACTCTTGAGGATCAAACTCTCCCATTCCA
GCACTGGCTTGAGAGAACTGGGCGCTTCCACCTTCACTGCCACTTTATCCCGACTCTCGATCGAGTATGCCGAGTAAATCTGACTAAATGTACCCT