Description :
From Genome Similarity Track
Location :
contig_60:216372- 238811
Transcript NameFunction/comments
g11186.t1RAW43636.1 hypothetical protein PC110_g138 [Phytophthora cactorum
g11187.t1hypothetical protein
g11188.t1hypothetical protein
g11189.t1RAW43643.1 hypothetical protein PC110_g134 [Phytophthora cactorum
g11190.t1XP_009515897.1 hypothetical protein PHYSODRAFT_322268 [Phytophthora sojae
g11191.t1hypothetical protein
g11192.t1hypothetical protein
g11193.t1hypothetical protein

Sequence
22439 bases(100 bases per row)
GCTTTCACGATCCGGATAAATGTTCTCTGGATTTTTACTCATCCTCTACTTTTATCCGGACAAAAGAGATCTTCAAACTGAGATCTTCACTTTCCAAGCA
GCCACGAACCCGTCAAGTCTCGCTGCCCCACCATCGCAATGTCGAACGAGCTCTTCCCATCAGCGCACTCCAATACTCCATGCTCCTCCGCGCCGCCTCC
GCCGCCACTTTTCCGGTCTACGGGGGACCTGGAGAAGTTGATTTCGCCGCATTTCGTGGCCCCGGAGGCGCGGCTGAAGCCCATTCCGACCAACGAGTGG
TGGGGCAACTTGCTGGCGTGGGACGGGAAGCGGGAGAGCGACGCCGTGTTCGCGGGGCCGTACACGTACAAGGTGGTGCAGGGCCAGGCTGGAACCATTG
GTAGCGGCCTCTCGGTCAGCTACTTGCTGCAGTACCGCACGGACGGCCCCATCAACGACAATGGAGCTCCTCGCTTCTACTTCTACCCGCCGACTATCAA
GAACTGGATCTTCTCTGCTGTGGAACTGGCGGAGCAATCGGGTACAGCCCCTCTTAGTATCCAAGATTGGGACGATATGGGGGTGCGTCTCGCCATGGCA
GGCATGAACATGTACTTGGCCTTGGGCACCGCCTTCACGACGGTGGAGTATCAGGACATGCAGGTGCAACTTGGCACCGATCATTGCATTGTCGCTATCG
ATGGAGCCCCGGCTAGAGAGGGGCACCAGGTGAACGGAATCAGTTTTGTAGTCTCACTGAATAACGGACAACAGTGGGTGCTCTACTTCTTTTCGAACGC
TGGGGGCAACACCTCGCTGGTGTTCAAGGACAACAAGCTCACGACTACGTCGAAGTTCACGGGAGTCGTGCAGGCGGCGTTTGTGTCGACAAGTGCTGTG
CAACCTGCGGTGCCGCAGGACGACCACAAGATCCTGCAACTTTACCATGCAAGTGCAGGGGTCTACCCGAGAGGAGTCTCCGTCCAGACGTTCGATTCTG
AGTCGTTTGCTTTCAACTGGCAACTTGTGAGAGCCGCAGGCAGCAACCCGGGTGCACGGTTCCTGCACTTTGCACTCACACACCTTCAGGCGATGCTGGA
TCCGTCTACTGCTGAAGCTAAGCACGAGCTTACACTGCACTCGCATACTCATGGACCCCTGTTTGCGTACGCGTTGGTATCTCCGCCAGATTCTAATCCA
ACGTGGCTGTGCCACGTGCTGCAGGCTGAAAGCAAGGGCATCGAGACGTGCACTGCATTTTACCCACCTCATGCCGGCTCGATCACGCGTGAGGTGGTGG
AGAAGCTGAACTTGTGCCGAGTCGTCACAGATGAAATTCATGGGGATTGGTCTTTGCCTCGTGAAGGCAGCTACTACTTCAAGGGCAAGGCGCTGCAGAA
GTTTGGCTCCATGTGTCTTGTTGCGCAGCAGCTTGCTGACACAACCAACCCAGAAATGAGGGAAGTGGCTCAACATGGCATTTCCAAGCTGCAGAAGTTG
TTGGCGGACTTTGTGAACAATCAATCAGCGTTCCCACTTGTCTACGACACAGTGTACAAGGGAATTATTTCCAGCGAAGCCATGGCTAAGAACGACATGA
ATGTCGATTTCGGCAACAGTGTGTACAACGATCACCACTATCACTACGGCTACATTGTGACCGCGGCTGCCATGGCCCTCTACTTGGATGCGACGTGGCG
TCATTCAGCCGATGCTGTCAAGGTGCGCACATTCATTGACACGCTGATCCGGGACGTTGCTACCTCGTCGCCTGCCGGAAGTGACCCGTACTTCCCGCGC
TACCGCTACTTCAACTGGTGGCTAGGTCACTCGTACTCACACGGTGTGACTCCAATGGCCGATGGCAAGGACGAAGAGTCAACGTCGGAAGAGGTTAACA
TTCTCTACGGCATTGCACTGTACGGCCAAGTGACGGAGAATACCGAGCAGGAAGCGCTGGCAAAGCTGATACTGAAGGTCTATGTGCGTGCGGTGAACAC
ATACTTCTTGTTGCAAAATACTGGACCTAAAATCCATCCGGCGGGCTTTTCAAAGAACAAGGTGACGGGTGTTTTCTTCGATAACAAGTGCGACTACGCA
ACGTGGTTCAGCCCCAACAAGGAGTGCATTCACGGCATCCAAATGATTCCTGTTTCGCCGATTCTCGAAGTCTCTCGAGCACCGAGCTTCGTGCGCGAAG
AATGGGACGAAGTGCTCAGCAAACTGCCGATCGTACACGACTGGAAGGCGAATCAATCTGGCTGGACCTCGCTGCTATTTGCAAATTACAGCGTTCTTGA
TCGAACCAAGGCTTTGGAGGTGCTATCCCAGTGCCCGATGGACGATGGACTCAGCCGTGCTTGGGCCCTGTACTACGCAGCCACCCGGCCGTCACCCCCC
TGCTACTAGCAGGCTGCTAGTCGAACCTCGCACGCAGCTAACCCAGTCAAATAAGTCTCGTGTTTCGACCCCCCATTCCATTAGCCACAAATCGCATCTC
TATCTGTTCATCAAAACTGTTGCACCTCTTGTGGTTTGCCTCTATCATCATGAAGAAGTCATCGCTTGTAGCAGGGATTGAGCCAAGTTGCTTACAGCAG
GCGACACTTGTCGGTCACGTAGCGAAATTAAACAACTGCAAGCCGTGAACGGGTTAGACGATGCAATAAATATGTAATCAGCTGAGCTCGTACCTGTCGA
TGAGACGTTGAAGCTCTGCTGGGGGCAGTGCTCCAATAAAGGCAGGTAGTTTTCCGACGAGGGCCCCCACCACCTTTAGTCCGCTCATTGCAACGGGCTC
ACTTTGGGTGACCTCAAGACGAGCTGCAGCTATCTCGAAACAGATGCGAACAAGCTGCAGATCGGCGTTGTTTTCCATGGAGAGCAATTCGCTGGCCTTA
TACAAAAATGCAAAGATGACCTGTAGCAGTAGACACCGCATGAATGAAGATCAGGCGAAAAAACTCAAATGACTTTGGGGGTAATACAGCCATACCTGCA
GCCCGCCAGCAACCACACCGTCTTCTGAGCAATGCTCGATAGCTAACGCTACGCGCGAAAAGAGTCTCTGTGCTTTCCAGCTAGCGAGCATATTGTTATC
GGATCGGGAGATGGCACTACCAAAGCAAGCAATAAGTTAGTAGCCCACACGGATAAATCGATGATCATGAGACTGCAATTAAAGTGTACCTGAGTAGAAC
GTTACAGCAACAAACGCGGAGTTGGAGAGGTAGATCACCATGTCGAATTTCACTCCATACGCTAACGAAAAGCGTTTGCACGCGCGAGCCAAGCGTCTTG
TGGTCGTCGTCCGTAACGTGGGGTTCATCCTTCGTGCCCCCGAAAATCCAAACTACGAGAAGGTTCAAAAGTGACGAGCCATCCGCTGTAGGCAATTTCG
TACTGTCTTGCTCGCATTCATCTTCAGTAAGTCTGGTGAGAATTGACGCGATGCAATCAATGCACCCGCGCTGGAGATCAATGAGCAGTGATTCATCCAT
TGCGAAGCTTGAACCCGGAGCACACGGGATCCCCAGGATTTTGACCAGCACGACAAGTGCTTTCGAAGTGATATCTCCGTTATACATGTCCTCTGAAAAC
ACCCGATTCAGGTAGTAGACCATTAGCTTGGCCGTCACTAGCCCACATACATCCGGAACGATTTCTTCACTAACGATCAGGGAACTATTTTGCTCGTGGT
GAGGTGTTGCCTCCCGCAGGAAAGCAATCAGATACGCGAACGCGAAGGGTAACACAAGAGGCGGAGGGAATTTAGCTAGTCCCTCCGTAGCGAGCATCTT
TACCTCCTTGAACTCCAGTGGATCGACAACGGAGCAGGCTAGGATGTGAAACAAACGTTCGTTTGTGACATCTCCATCGCTTTCTGGGGCTGTCGCTGGA
TCATTATATCGCTGATGGTCGATATACTCGTTCAGGTGGTCTAAATCTTCGCGCCCACACTGTATCACACAACCACATCAAGTTAATATCAACCTGGGAA
AACAGCGTACAGGAGAAGTTGCTCACCGCCAGCGTCGTAGCACAGTTATATCCAAATATCTGTCGCGGAAGCATACGTAGCACCAAAAACGGGGCCAACC
GAGAAAACAATAGCCCCTCCGTAGCTTTAGCAGCCGAGGAGGATGTGTCGTCAAGTAGGTCTTCACTTAAACGCTGCAAATTCTGCAGCATCAAGTTTCA
AACACATCGATTAGAATTGGGTACAGCTATTTAGTGCTTGCGGCATCGCTCGAAGTTTACCATCATGTGAGCGGTAAGCTGCTTTCCCATCGTCTGAAAT
ACAGCTTCGTCCACCCAACCACACGCCACAAATTGCCGTAGCATCCGGAAAAGTAGCGTATCACGAGGAGAGCCAAAGATTTTGCGAAGGAGAACGCTTA
AGACCTTGCAGCGGGCATTTGCGAACTGAACGTACTTGTTCCACCTGCGCAGCCACACATAGAGCAGCGGTATATTTTAAAAGAGGAACACGGCATCGGA
TCAATACAGCGATGCTCCTACGTACCCGTTTGGACCAAAGCACAGCAAGAGTAACTTTTCTTGTAGCTCTTCTAGCCCATTGTTATCTTTGGTGTTCCCT
TTTAGTAAGAATCGTATTCGTTCCAATAACGGGGAGATCCAGGGGCTTCCGACGAGACCTTCGATGTCTGAAGGCCCCCAGACTGACAAGCATCAACGAA
CCATGTCACCCTGGTTTCCAGCGAATATTGCGACGATGTCGCGAAAAAATACCCAAGCACCGATGTCACTATGAGGTTTTCAGTGTCGTGAACACCAGCT
GCACACAATCCCGCAATACATGACATAGGGTCCAGCGACGGTAAGCAAGAAAGTGCCTAGAGACAAGTAATATGTTAGTCTCCATTTTAAAGAGGAACAT
GTGCACCACACGATGCAGATAGTCTTACCAATCGCCGAACATGATCATTTTCGTTGTCAATGAGACCTAACAGTACCGGTGTAAGCTGGCGCCTGTTCAT
ACAGGAATACGGCGGTGAAATCTTCGTTAGCTTCATTATGAGCACAGGGACCATTAATGTTGTCAGCAAGACTCCTACCGCCAGTGTCGATAGAGCGGCA
CTTGAGTGTCTGCACCGTCCAGTTGGTAAATGAATGTGCGCACGAGAGAAATAATTTTCTACACAACAGACAAAGTGCACAGCAAAGCAAACATATTGTT
AGCATTGCAAAAAATTGCATCAAACATTTAGGGAACAACAATGTGCTCACCCGAATTCTTCGAATGTGAAAATCTTGCAGGTTCACTACAATCTCCGTGA
TGAACAGTTCTCTCGATATGATAAAATCTGCCACAAACAACTCGAGTTCCGTTTGATCTTGTGATCCATTTGCAGTGAACTCTGAGTGAACAGGAACTGC
CAATTCGTTGTCGCAAAGACGAAGTAACTGCGAAAGAAGCTCTTGTTCGTCGTCGTGCGTGGCTAAAAGACCGAATGCATCACTGGGCAAAAGTACACTT
CGCAGAACTTTGAGGATGAAACAAACTGCTGCTTCATCACTTTTCTTGATTGCTGTAGCCATCCCTCTGACGAAAATGAAAACGAAGTACTGTTTCGTTT
CGGTTGATAAGCTCTTGAATGCTTGCGAGCATCCTTTGACACCACCAATAGAGTCCAGCAATATGCAGATGTAGCGAAGTTGGGCATACAGCACTTCACG
ATTGGTTGTGTCGCGATCAGTATTTGGTTTGATGTCCAAAACGCTCAAAATCCACCTCTTCAGAGCTCGAGATAGAATTTCGGACGGCTGATTGTTTTGA
ATTTGAGACGATGCTTCACTACGCGTACACAGCAGTGAGGCGGTTGCCTCCCAGTGCCAGCACATCATATCCAGCACCACTACCTCATTTAAATCTGATC
CAGTTGCGGCCTCCCCATGCTTGGATAATAAAAGCGCATCGCACGCTGTAGCGTACCATTGGAGGTGCTGGAGTGCATAGCTGAGGAACTCACGTCGTGT
TGAGTCTAGATGCCACTGCCGTAACACGGTTAGGAAAAACCGCACGCCTGTCACCATTTTGTGCATCAACTCCTTGCTGGCATAACTTCTCTTTGTTGCT
TCGTCCGACATCAAATAAATCGCAGCAATGTCTCCACACAGTAGCGCAAGTGCTTCCAGGGCAATCAACGCAAGTTTGGACAGCTTCACACGCTGTGAAT
TAGCAACACGACGTACTCCTCGCTCAATAATACCACGCAGAGCATCCATGTACGCTCCAGCTCGATCACCCAGCAGAAACGGGCATTCGCTTCCAGAAAC
AACAGTCATCATCTTCCGACGACGTCGTTGTAGCAACTCGAAAAGTGCAAGACAAGCAGCCAGCTGATTCTGCTTCTCGGCTATCGGCTGGATCCAATCC
AACAGAAGCTCCCGCACAAAGTCATAACTCAAACTCGCAACGGCGCACTCACGATTCATCATCCAGTTCAGCAAAACATGCAGTTTTTCCGCCTGCGGGC
CCCAAATGCAGCAGTTGGTACGAGACGCCGTGCAATCTCGCGTCGCCTGCATAATTGCGGCTGCAGCTACAGCACACACCAAGTTTCGGTTCTGCGCAGT
TGTCCCAACCTCAATTCCAACTTCATAAGCGTCCGCAACCGTCGACTGCAATGTACCACCAACCAACAATGAGTCAATTTCTACCATTTACAGCTTCTCA
CAACAGTTAAAACGCACCAAAGCAGCTTGCAACCGTGCAATCCGCTTGTGGTCCGACAGCGACAGCACTCGACCCTGCACAGTCAATTTCTCCAATGAGT
GAGGCCACCCGCACCACTATCAGCACTACAGTGCATTGTTCAGCCCTAATTGACACCTCTCCAGTGCGTTCCAGCACGTCAACGTCGTCACTGCCACTGG
GTTTGAGTAAGGACTCAGATCTGATTCCATTCTTCACCCGGTCCAGACTTGTGATTGCCGCCTCCATCTACGCATCCACAAGGATTAACTTGCACGATTA
TAATAGATAAAGGGGAGAGTATAAATTTACTGTAGACATACGTGGAAGAGCTCACAGTCCTGTAGCACTCGCAGCAGCCGCCCCGCGCTGTCGCGATCGC
GAGTTCCGGCCGCCATTTTTTTCGTCTTGTCAATTCAGTCACGGTACACTAATCCAGTGTGGTGCACAAAGATATACATATGGCTACAGCTGTGAAGAAG
GGACGGCTACAGTTGAAGCAGCAATGGATACAGTTGAAAGACACTGGTTGAGCCATTAGCACATGCATTTTCTCATTCGATCGAGATGGTACCAACTCCA
TTTATACATACAGAGCTAGAGCTGGTGGCTTCCTATCACTCGGAAGGTCGTGGTCCTGTCCTGTCGACTGAGGCTTTACAGCGTCAGGGTGTTGGGGTCG
TCTTGGCGGACTTTGTCCACGTCATAGTACGTCGCACTGTCGTCGGAGTGAGCGCTCAGGAACGACTGGTTCGAGGACTGGTTCGAGGAAGCTGATCTCC
TGCGGTGCGACGGGTAGTACATGCCGTCGTTCGTGCTGGTGGTGCTCACTTGGCTCTGGGCGTTGAAGTCCACGCGAGATGTAGCGAAGTTGACCCTCGA
CTGGTAGCCATACGAATCCACCGAGTCGCGCATCGAGAACGCAGACGAGGTCACACCGAGAGGACCGATCTCGTAGCTCTGGCCTTCTACGTCGTTGGTT
TCACTTCCTTCCTCCTCAACGCTAACCACGGTCTTAGATCGACTCTTGAACCAGCCGCTGCTGTCACCATCAAAGCTGTTGTCAGAGTCGTTCGAGAAGA
TCGACATCTTGGCCTGAGGACTGCTACCGTAGCCTTTGCTTTTGCTTTGGTTGCTAGGAGCAGCAGCACCCATTGCGGCGGAGAACGTATTGTCTTGCTT
CACAGCCTGTGTCACGTCCGGACTGGTAGCAGCAGATGACACAACCGAGTCCGAGAAGTTCACGTAGGACTGCTCCATAGGAGCATACGAACTGGCCGAG
GAAGCTGCCGGGGTAAAGCGCTGACCCATAGTCGATGCTCCAGGAGCAAACTGCCGGCGTGCCATTGAGGGTGCTGGCTGCGCGGCTACGACGTCTCCGT
CAACATCCACGTCGTCGATATCCACATCCTTGTGCAGATCGTCCAAATTGAAGCTGTGCTTCCTTCGCGAAGACGAACTACTGATACCAGAGTCCGTAGC
GGAGAAAGTGCTGACATAAGCGTCGAGGGGCACAGTCGATGGACGTGAGCCGAGACCAGAACCTGACATCCCCGTTGCGATCGAAGCACCTCCTCTTGAA
GACTGGCCTCGCGATGACGGCGGGCCTCTCGATGACGATAGACCTCCGGCCACGTGTTGGCCCCTCGACGAGTTCTGTCCTCGTGACGATTCTGCCCTCT
TGAAGACTGTCCTCTCGACGATTTAGGTGACGTTGAGTGTCCCGCTTCATCGTCCGTATTCTTCGTACCAAGGTACGCTGACAGCACATCGTACGTCGGA
ATTGGTGCCTCGGGGATGGGAGCAGCAGCAGGGGCAAGCGCTGCATTGCTGACCGCAAAATCATCAGCGCTTTGCGTCGAGTCTCCAAACGAGTACTGTT
GGTTACGAGAAACGGGTGGGCGAATCTTGCCTTTAGAGCGACTGAAAACCGGAGCAGGCTCCGGGGCCGGCTCCAGCATAGGCACGTGCTCTGAATGACC
ACTGCGAGAACTCTGTGTAGTACTGTAGCCAGACATCGCGCTCGTCTGAGACTGGTACTGTTGCGGTTGATACTGTGGTTGCTGGTCAAGCTGTTGCTGC
TGCTGTTGTTGCTTATTCTCATACCAGTCCACGCCGCGGCCTGCTGGGGTAGTCTCAACTTGCTCGTAGTTGCGAGCGTTGGTGGACGTGTGGTTGCCGA
ACTCGAGGTTGATGTCGGTGGCGTCCAGGCTGGAATTTTCCTTGCCATCCTTCTTGTGACGACAAGCAACGATCATCTTGTGGATGATCGTGTACGCTTG
ACGCACGAATAATAGGAGGAAGATGAACATGTTCACACCGATGATGCCGTACGCCACATTGTCGCGCACAGTCTGCGGGAAGTAGTCATCTCTTGCCACG
ATGAGCATGAGGCAAATGAGAACGACCTTCATGAACACGGACGTAATGCCGATGTAGTACAAGAACCGCAGCAAGTTCGGCTGACGAATTAGCAGCAGGA
TCAGGTACACCATTGTGATTGCCAGGATGCACAACAGTTGGGTCGTGGCATCCCGAACAACGCCGACGATGGCGCCGGTGAGCACTGCCAGCAGAATACG
GGGGATGAAGAAGAAGCGGTTGTCGAAGTTGTACTCGTCGTAGTAGACGCTGTACTTGCTGCTGAACGCTCGCTGGTCATGCTCGTACGTTCCGACGTCC
TTGAGCTCGTCGGTGTTGTTGCCAACGACGATAATACCAAGTCCAAGAGCGCACAGCACAACAGCGACAAGTGCAACGATGCCGAGTGCGAAGCGCGAGC
TAGAACCGCTTGCTGAGTCGTTCGACGACCCCTCCGAGATGAAATAGCTTCCTGCCATGGCAAACATGTACTGCGCTAGCAGCAGCGCCAGCACGCCGGC
CCAAACGACCTTCCGATACCACTTGCGCGCCACGTCACCGAACGATTCGTTCTTGGCCAAGGCGCCCGTTATCAGTACGATCACCAGGTACAGAGCGTGC
ATCGCCGCGACTACGATGACAAACGTCACGAGCGTGTAGAAGAAGAGGTCGTCTGCGTCCACGCCGATGAGAGCCGAATATCTCGCCGGGCCTGACTCTC
CAGCAGCCGCGACGATGCCCGTCGAGCCTGAACCTGAGTCCGCGAGTCTTCTTGTGCCATTGGTACTGCTGCTGGAGTCGTCACTGCTCCCCTTAATCAG
GTTAAAGTTGGTCCACGAGAGTTCCTTGGAGAACTGCAACAAGAATGTCGGCGCTCCCTCGATCCGGAGCTGGCTGATCATGCCTGCGAACTGTGCCTGC
TCCACGATGTGCGTCATCTCGTAGAAGCCTCCAGAGAAGCTCAGCGCCGCTGCAGCACTGGGCATTATCGAAGCCCAGAGCATCGAGCCCGTGCCAATCA
CAGCGGCGCCCGCCAGCGAAGTAGCAATGACGCCCGAGGCCGTGGTGCCGGCCTGCGAGTCCAGGAAGTGCCGCGTGCCCGTGGAGTTGGTGGGCCACTG
CGTGTTACTGCCGAAAACACATCCGGAGCACGAGTTGGCCTCGACGTAGCTGGCGTTCAGGGCGCCGAGGTCCACGTCCGAGGCGAGGTGGAGCGCCTGG
CGGATCTGCTCCTCGCCCCACGGGATGGCGTACGTGTAGAAGAGCAGGCCGAGCGCGGCCAGGAAGGCGAGTGGCAGCAGCAGCGCGCAGAGCTGCGAGA
TCGCCATGCAGCCGCAGCATTTGGCGGCGCAGCACAACAGCCCCATGACTACCGGTAGCTTCGGGGTGGCGGGTGGATTACCAGTATACGAGGGCGGCGC
TCGTGGTGGTGGACCTGCTGAAGCGGAACTGGCTGCCGTTGATGCGCTTGCCTCGGTGGATGCAGAGGCGAGGGGAAGAGCCTGTAGGAGACTCGCCCAA
TGCACAAAAGTCGGATGGGACGCGAGGTTAGAGACCCGTGTCAAAGTGCAAGTGTTCAGCTCGAACAGCTCAATCAGCTCTCTTCAATATTGACCAATGG
AAGCACGCGAAAACGATTCAGACCGTTTCGGTGAGTGCACTTTCGACCAATGGGAGTATGAGACAGGGGTTGTCAAAACAACCGTACATGGAGGCTTCTA
GCACGTGCATGGCACGACATTTGTTGGCGCGAAGAAGGCTTCCACTGCATGTACTACATGTAACAGAATCCTTCTTCGTCCTTTGGACAGTGTGTTGAGC
GTGCTGTTGCAGGCTCTGATAATCGAAAAGCACGATCGTTTGACGTACGTGATAGGATACATATACGGTAGCTTTCTGTGCGGACTTTTACTCGAAACCA
CTTCTCTTCTACCGAGAGCGGAGTTTGCTTTGTGTTGGTGAGTCTCCTTTGCGTAGCTTTCCTGGGCGATGTGGGGGTGAAGAATACATGTACGAAGCAC
GCTGACGGCGAGAAAAAATATACCGCGCTTCGACAACGTCATGTCATGCGGCGACGATGCTTTGACTTTGATTGGTACCTATGTGGTTTACACAATGCGA
TGTTCTAAATGTACGTTTATCCATCAAACCCGTTTCTAAACTCATTCGATCGTTTCTAAAATAGACTATGGCCAGCGCGACGCACCCGTTTGAATGGTAC
GGCCGTGCACCGACGCCCCTAGCGCTCGCTCCGTGCCGCCTTCTCCCGCTTATCAAAGTTGACATTGCTCTACCCGTTCTCTTCTTCCCAGCGAAGTCAG
CCTCTCGTTCCCCGCGGCTGTGGACGCGCAGTACGTGTTGCAGACGCTCGAGGTCGACGATGAGCTGCAGCCCGACAAAATCCACCGCACACTGACCGTC
AAGGGCACAGAGCTCCACGTGTACGTATGAGGCTATTGATTCCGTCTTTGTCTGAGGTTACTTTGTGGTCTATTGGTGCTGACTTGTTTGTTGTTTGTTG
TTTGTTGTGCGGCCGTTTGGTTGGTGGTGGTGCGCTGCAGCCACTTCGAGGCCACGGAAATCCGACTGCTGCGCGCCGCCGTGTCTTCGTTCTACGACAT
GGGCGTGCTTGCCGCACGCACGCTGCTGGAGTTTAAGGAGTAACCGAGGCAAGAGGAATAAAGTACTGCGTCTGGGTTGACCAAATCCGTTTCGGCCCAT
TGGGAACTGCCTCCATCATGCCCGATCCACGCATCAAGTGCTGACAGGCGTCACTGCTTGACCATGGCAGCAACGAGTTAACCTCATTTTCCGCTAGCAA
CGACTTGGCGCGTTAATTTAACTGCTGGTGAGGCATCTTCAAACGGCAGGCCAGGAGTCTGGTTCGTTTCGACAGACGGTTTGGTTCGCAGCAACACCCC
TGAGTATCTGGTAGAAGCTTCCAGCAAGTGGAGCGCCTCTCTAGTGTGGCCACGCGAATTCACTCAACCGTGCGATAATGCATCGTATCACTGCGAGCAA
TTGCTATCTGGAGCAGCGGTTGGACATTCCATTCTGCTAGTCGCGGGAGCTCGAAGACACAGAATCAAAATGTCAAGTGTAGCAGCTCGTGAAAGTGGTT
CTGGTGACGAGCATAGCGTATCAAGCGTATCAAGCGGGGGTCAATTGCTGCGGGATGGAGTCCATCTGATGGACCGTTGTCCACTACAACACAGTGCTGG
CACCTGCGACAGATGCAAGCAGAGAGGATGGATTTTACTTGTAGAGCAGGAGAGGATGGCTTGAGGTTTGCTTGCTTTTGGGATGCGAGCCGACACCGAT
TGCTCTTCGCCGTGTAGTGTGGGTCTCTGTACTTGATCACTGCTGTCCCACGCCGAGACTACTGTATAGGGGGCGGACAAATCCAAAGGCTCGCCCCAAA
CGCTGCTTTGAAGCACAGCGGCGGTCAACTTCCCGACATGAAAGGACGACCGCAACTTTGCTGAGGAAAGCATGGTGGGGGCTAGTGCTCCAACGCGATG
ACTTCCGTTGATTCCGTTGGTCTCGAGGCTCGGTGACGTTAAGCGCGTAGTGAGCGCTGGTTTCGCGGTTTTTAGCCGGTTTCCGGTCTCGTAACGGGGC
CAACAACTCCATGCAGCATTTACGCTTCATTTCTCCGGACGCAGAACTATTCCTTCCGGTTGCTCTAGCCTCACAGCCAAGTGAACCCCATGGGAAGCAC
CACACAGCTCCATCTCACAACTCAGGTATGGGTGCAGTTGAGACGGAGATTGCCAACTTGGAAGCGATCGCCGTTACCAGGGGAAAGCAAAAGCAGTCGG
CAACGCAGACAAATGTCCTCGTGGTAGGAAGGGGGGGGGCTGCGTGGCAATCGTCCTCGGCCGCTGCCGCTGGGTGTCGTGCACATGCGGACGGGGCTGG
AGACGATTATCATCTTTAACCCTTTCACTCGCAGCGCGCCACGTTGTTCACTGAACCTTACGAGATTCGCAAGGTGTATGTACATACAACGCTGGGTGTC
TGGATCCCAGCGGTGGTTGGAATGTGACCTGCCACATGGGACTTCCGAAACAACCGAAGCCATCGCTAATACCTGTACCCAACAGGCGCCCGCAGCAAAA
CCATGTCGAGACGACCAAGCAGCTGCCGTTTTTCTGAAGCCGTTGTGTGTAACGTGCAAGTTGTCGGCAACTTGTGTCACCGAGACACGGGCATAGCCAG
CCGTCGATGTCCAGCAGGCGGGTTTCTGGGCTGTGCCCAACGTCCCTCTCCTGCTTATCCTAGCGAGTTGAGGTCAGCGTGGCGGCAGTCTTTCATCACT
CGCCAATCCGCCCGCTTCCAGAGATTCACCGTCCACCTCGGGCTGAAGCATGCCGTCCCTCTTCGTTGACGAGCTGGCTGTTGACACCCGAGAGCTCGTG
GAGCGGCACGTGGCCGAGTCGTTCGCGAGCCACCGCCCCGTGTCCTTCGACGACGCGTTGTCCCGCTCGCATCACACGTTGCGCGGTCGCAACTCCATGC
CGGCAGTGCTGCGACTGTCGTCGGACTTGGGCTCCAGCCGCCTCTCGAGCTTCGGCAACATCCCCGGCCACGAGGTCATCGAGACGTCGGTCCGCTTCGT
GGGCGTCACCCGAGTGTCCACCCATTGCGAGTTCCGGCTACACGTGGACACTGGCAAGGAGAACTTCGTGCTGCAGAAGCGCTACTCGCAGTTCCGCGAC
CTGCGCCAGCAGTTGCTGCTGGACGGCAAGTCTGCTGCAGCGGGTGAGAAGGGACGCAGCGGCCAGTGCCGCAGTGGAGCGTGTCTGCAGCTCGCGCAGC
AACTCGCCTTGCTCAAGTTTCCTCGACGCAAGATGAAGTTCAAGCTGCACCGGGACGACGACGTCCGCATTGCAAGAGAACGCCAGGCTCAACTGCAAAA
CTTCGTCGAGATGGTGCTGGCAGTGTACCGCATGGCGCCCAAGCGGCAGGTGCGTTGCTGCGTCAACTCGCAGTGTCGAGTGCTCAAGGCTATTCGATCC
TTTCTAGACATTAAGGATTTGGGCGAGGACCTGGTTCCGGACTGGAAGTCGGTCAGCAATGGCAGTAGCACCGGTGGTGACGTGCCGATTCTGGACACGC
CGCCGTCGACAGGGGGGACCAACCCGTCACCAGTTAGCACGTCGTCCAGCGATGCTGCTGGCTCAAACGGCTCGCCGATCCCCGCGAGGACGTCGGCCAT
GTGCTTGGAGGAACTGTACACGATCACAGAAGACACCGAGCACGCCTTCGTCTAGACGATGTAGCACGACATAAGGACGGATGCAGTCCTAGCGTCGTGG
ACGCGACAACCAACCAACTCACCAGTCGCCATCTGTAGTAACTTATTTGCTTCGATTGTAGCACCCGCTCCATCGGTAATTCAAGAAGATGTAGCAATGG
AATCCCATTAATTTACCTTTGCACGTGAACACCTTTGTTCGAGTTTAGTGTTCCACACCTTTAGCCTTGAGCAATTCTACGATCACTGTTGAGACTTTGT
CCTCGTCGTTGCTCAGCCCGCCCATGATCTGCGAGGTCTTGCCCCACTGGACGTTGCTCACGAGAGCCTACAACCAGCAACAGCAGGTGTGTCCGTTAGC
TCAGTTGTGCTTCCTGTATCCGTTAATCGAAAGCGTCCAACCAGTTGATCAGTTACCTGCTCATGTTTGTTGTCAGTGGTGCCCCGGCCACTCAGACTCG
TGTTGTCGCTGTCCCCGGCGCGCTGTCGCGCCCACTTCATCAAGTTGTGATTTCATGGACATACCAGCACCCGATAATGTAAGACATGCCAAACTCCTCA
TCTGAAAAGCATGAAGTACGTACGCTTCGCCAGCTACTATCGTTTCCACGCGAACGACGCGGAGAGGGTTTTGGTTTGTCGATTATTGGCTTTTGCGCTC
GTCGTAGTTGGCCACAGGAGACGCCCGGAACGCCTCGCTCGGTTTGAGCTCCTCTGCCAGACGTCGGTGATAATGGCAGCTTTGGCAGACAGAAGTTCGG
CTCGCGTACTGATCGATAGCAACCAAGATCTGGTCGTGGTCCCATGGTTGGAATGTGCTCTTCCTCGTGTCTAGTGAGAACAGTGTCCACCAACTCTTGT
TTGTACTGGTTCCACCTCGCCTCCCTCCGCAAGTCTCGCGTGACGCTGGAAGTATCAGCACGCGCTGAAAGACCAATGACTTCCTGGCGCAGCATTTGCT
CGGTGGTCGCGTCCTTCAGCACAATTTGTCGGAAATCCACGCGGTCGACACGATACAAAGTGGCCGTCGGTGAGGAAACCAAGACCGAAAACACCGCGTT
CGTCACACCAAGGGTAGCCTCGTAAAAGCCAAAGTAGTGCTGACTTCACAAAACGCAGTGCGAGGGTCAGTATGTTAGATAAGCTTCGCGTCGAGAAGCG
GTATTACTACCTGCAGACGGTCGATATTTCAACAATGCATGGCTGCTTGCGGCTGTCGTGCTTCTTCTGGTCGAAGGCCGAGTAGCGTTTGACCAGCCTG
CACTCACCATGCTTGATGAAATAGAAGTTATCTTCGGACGAGAACCAGCGGAGTTCAGATCAAAGGCAACAACAGAAATGAGCATCACGTTTACTTACTT
GCAGGTTCGCCTTCCACAACAATGACATCGTTGTATGTGTGCTGTATCTTCTCCATTCGGTCACACAGCTTCAAGATGCCTTCGTCTTCCCAATGATCCA
GGCAGGCCACACCTGCTAAGAATGTCATTTTCTCGCTGGCAGCAAAGACGACAATTTTGCAAGTTAGCTAGTCCACGTGATTGAAAGTTGCGTAAAAGCT
CGTACCGGAGGTCACGCGACAGATTGCACGCGCGTAGTGCCATGAACGTGTCACGATCAATCTGCATGAGCAATGTGGTTTCCGTGGCCACAACTGAAGC
GGTACGCTGTTGCTCTTCAAGGAGCAGGCCAACGTCGCCGAAGACTTCCAGGGGCTTCATCGTGCGCACAATGTACGTAGCATCATGTGATCGATCGATC
TTTCCGCCTGGGTTCAGGAAGCTGGAGTGCACGCGGGCTCGATTCATGATCTCCTCGAACTCGTTCAGCGTTGGGGCTGCCATTCGCGAAAAGTCCATGA
CGACGCTCATCGTTCCATACATGATGCAGTAGAACGCATCTGCACGATCACCGATTCTGAAAAGCGCATCTCCGTCCTCAAGCTCGATGCCTTTGGCGGC
CTTCAAGAACCGTAGTCGGTCTCTCGGTGGCTGCTCGCGAAAGTACTTGACGCGTTGAACTGTACAGCACAACAGCACAAAGTCAATGCAAATAATGACA
AGACGTCGGCCGTGAAATTATCTGTAGATACACCGCTTGTAACATACTGTATTGATCGAGGAACTCGTAGTCGGCCTTGCATCTCGCCACTTCGGACAGC
AGAAGAATTCGCCTCAAGTTGGCTCGCACCTCCGGAAGTTCGTGGTTTAGCTGCTCCTGCCAGCTCGCCCTCTTCGACAACCTAGCAATGGTCACATCGT
GTCACAACATACTACCAATATATGGTACTATCGGCTCTCTGAATGCCAGGCATACGCACATGCTGCGCGGCTTGGCGAGTTCAAGTGGACGACCAAGATG
TTGAAGGTAGTAGCCATTTAAAATTATAAATGGCTACATGTACCTAATATAGGCGTCCTATGCTAGGTTGTCTTATGTCATCCACACTACTTCTGAATCT
CTTTTTGTCGACCACTTCACTCCCACACAAAGTCGAAAGGTGAGCACGACGTCACATGGACGCATCTGCTGCCTGTTCACGCTTGCGGATGCGCTCCCCC
AGCGCCGTATCGCGCGATACAACAACTTCACCACGTATTTATCCCTCTCACATACCTGCTGGTGTCATTTTCACGCAGATTCTCGCCGTCTATCGCTATT
AAACTCCCGCCTAACGAACACCATGGACCCCGAGACCAAGAAAAAGTGTTTGGACGTCGTGGAGCACTTTATCAAGCTCGATAGCTGCGGTGTGTTGCCA
TTTCTATTGAATTAGGCTTTTCCGGACTGGTAGCAATAGACTCACGCTTGTTTCTGTGGCTCCAGAGCCCTTCCGCGAGCGTGTCAACTGGGAGGAATGG
GGTCTGTACGACTACCTGCAAGTGGTCAAGGAGCCCATGGACCTGAGTACCATCCGCAGCAAACTGAGCAAGAACGAGTACAAGAAACCGGCCGAGTTTG
CGCGCGATATGCGCCTCGTCTGGCACAACTGCAAGCTCTACAACCAGGACGGCTCGGACCTCTATCTGCTGGCCGATGAACTGACCAAAAAGTTCGAGGA
CCGGGTCAAGACCATGAAGCTGGACGTGGGACCGGTCCCCAAAGCGGACAAGAGCATCCCGTACGGTACATTGATGTAGCTTTGATGTTTTAGTTGGTGA
GTTTTAACGTGGTATGTGCTGTTGAGTAGAGCCCCGAGTCTGGAGGAAAAGATTCACTTCAGCCAGAACATCTACAAGATCCCGAGCAAGGATTTGAATG
CAATTATCGAGCTGCTGCAGGAGCAATGCCCCAAGGCGCTGGACAAGAGCTCGCCCGATGAGCTGGACATTGTCGTCGACCACATCGACAACAAGACGTT
CCGCGACTTGGAGAAGTTCGTTCTGGAGAAGGTTCCTGAGGGCAGTCGCGAGCCGATCTCCACGCCCAAGTCGTCGAAGAAGTCTCGACGGCCACCGAGC
AAGAAGACGAAAACCGATCCGTGATCGAAGATGAATGCGTTTTGAGCGTGCCTAATTTGCCTTGACTTGTGTTTCATGCTATGCCACAGCCTTTCTGGAT
AAAGAGAGAAATGGCGCGTGTATTTAACCTCATCCAGGCACGCAGTGAAAATCGACCGTCTACTTGGACGGTATGACGGCTTATCAGGGTATTTAGTCAT
CTTTTAATCCCTTTACGCTTCTTCCCTGAGTATTGCTGCTCTCATTGCGTTATCTACTTCTTCTTTCGAAGCATAGTTGCAAGCCGTGTTTGCCGTTGGA
ATGTGGCCTCGAAGCTCTTTCTCTTCTGCTTTTGTACGGGCTCGTCAGGCTCGTGTCGAACTACGGCAGCTGCTGGTCTACCGCCGAGCCTGGTGAAGTC
TAGTGGTGGCACAACGATATTCTGTGCTGGTGATGCTTCATCAGAGTCATCTCTTGGCAACCCAAGCTGGACGGGAATTGCTGCTGAAAGGCGAGCCCCT
GCCTTGGCTCGAGTGGATTGCCACTGAGGTGGTATGAACTTAGGTCCATCAGGCTTCAGTGTTGCCCCAGTGCCGTGTGAGGCACTTGGGAGTGGAGCCA
CTGGCTGCAGTTTCGGCAGCGGGAGTTGAAACTTTGACGGACGGCGCATCGTTTTCCTCTCGTTCGTCGTGAAATCCCGCGCTGTGTGTTGACGACTCGA
TTCGGGCTGGTATTGGGACGAGCGTTTGTACTCGAGCAGTTCCTCCTTGTGGAGCTCCATCAGCTCTCTAACCACCAGTTGAGAAGGTTGTGAAAGGTAA
TATCGCGATCTTAAGAGTACGCGACGACCAGGGAAATGCATATTACCTGAGTGAAGGCTCATTGCTGTTGGCGGTGTTCCAGTTGGTGCCGTGAATCTTC
TTGCCGGCTTTCATGAGCCTGGTCCATTCCTGCACAGCAAAAAGGTCATGACGCTGGACGATGGAGGCCAAAAGCATGCTCAGCCTTACCTCCTCGTCGT
GCCGACTGGTTTCCACTCTGGACGTCACGATTTCTTCGAGTTCGTCATGATATCGCAACTGATCCTCTCGAGCAGCGAGCTGCTCTTTAAGCTTGCCGAT
ATATCGTCGAAGATCCTCCTTACGTCTGCCAAGCTGCTCAAGCACGCCTCTGCTGGACTGTTGAAGTTGCAGTGGCGGGTGATATTCTACATGGAGTTCA
CGGCAACACTCTCCTGTTACATGGAGCGAGGTGGTACAAAGTGTTCATTTCTGCGTACGCGTTCGTCGCTTGCGTTTTTGCATCTGCTGCTGGAACAAGC
CCAGGACGAGCAACAGTAGCAGCACGCAGCCGATGATCAAGCCAGGCGTATCGATCTTCGAGCCTGATGTGCCTCGAATTTGCGGCATTTCGCTACTTCA
GCGCAGCAAGGACATTGACAATGTGTCCTGCATGATCAAGCCGTATTTTTAGGCAAACCTCCGCGATTTCTTATGACACGAAGTGCATTTATTTCGACTG
GGGCTGAATTGGCGTCCTAAACTGTACAATAAGATAAATAGGAGCACGCAACGCAGCTCACACGTCCGCGACGAACACGTCTTCATCCACAACGAAGGCC
GACGCGTCGAAGCTCGGAGCCGGCTGGTCAGATGACGTCGGTGTGAGCCAGTAGTCACTGAAGTCCAGGTTGTCCCAAGTTCTCCCACGTCCACGGGGGA
TGTCTTGCCCTCTGGCAACGCGGCCAGCGCCTCAAGTCCCGTGACATCGAGGCATTTACTAGCGTCTCCCTGTCCGTCCTGAAGGATGCGATCCAGCACC
TCCTCGTCCACAGCATCAGGCAGTCGCTGCAGCTCCAACAGCTGTGCGTCCTTGGCCTGGAATCCGTCGAAATGGCCGCCGTCCAGCAGACCTAGATCCT
GCAAGAACCAGCCGGTGGGCCCTGAGCTTGCACTGGAGGCCTGCTCGGCCTGCTGCCTGGCACGTGCCTCCTCCTTCATGGCCAAGTGGGCGCTGAGCGG
GGCGCGTCGCGCGCGCTGACGCGTCTTCTTGCGCAGACGCTTGCCGGCAGGCTCATGGTCCGCGGAGGCCTGCGCTCTGGTCTTGCGCTTGAGCTCGAGG
CGGCGCTGGTTCTTGTTGGCCTTCTGCCGGTGCAGGTCGCATAGGTTGTGGCGCTCGCCGTTGCGCTTGAGCGCGCGCGGGTTCCAGCACTTCTTGCTCG
GGTAGCGGCACATGACCTCGGCGTCGTGCGCGGGCGAAGGCGAGGGCGAGGGCGTTGGGGGCTTAGGAGAGGGAGAAGCTGCGCCGGGGCGGGTGGCCAT
CATTTCTGGAGAGCAAAAGGACGAATGATCTCTCGCTGGCCACGCACCTGAGGCTGCTGGAAGATCCCAACTGCTCCAAATCGGATATGATGGCTACGCG
AGCCATTTGGGTGAACCAGATGTCGGTGCAGAGACTCAACCCATAGTGAGCGTCAATGCGCGTGGATTTTTGCCGAAAATCCGCGGACAATTCAAGTGAA
GTGACATCGGTGCCACCTTCCTGCACGCCCGGTGCGCCATTGACTGCCGCGGCAGCTCCGAGCGGTCGAATACGTTTTCTGCCCTGCTGACTGCAGCGGG
AAGTGGATTCAGCAGGTTGCTTTGCAGGTTATCAGGCCATGCGTATTTGTGCCAGTTGGGACAGTGCCGGCGGTGCGGTGATCAACTTCGCCTGCGCCGT
CGGGTAATCCCTCGACTCGGAATCCACGGCGGAATTGTCGCTGCAGTTTGCGGTTTGCGTAGATCAACAACAATCAGAAACTCTGGACTCTTGTTCAGAA
ACCGAGAGATTTTCGCCCTGCAGTTCTCTTGTGTTTTCGCTGCTCGTATCTTCGTTCTCTTCCACGTGGAGAAGGTGTTTGTGTCCATTCACTTTAGGTT
TGCTGTAACTTTAGGAAATTCTTACTTGTGGCACTGCATTCTGGCGGCTTAAATGTTGGCACGGGTGACGAGTGACGGTGCTCGCCGGACGTCCGGCTGC
CACGAGCTCTGCAGCGTCGCGGAGCTCATGAGCCCTTCTCCCGATCGAGCCACAGCAGTGGCAATAGGTGGCAGCAGCAGAGTCGGAGCTGCAGCAGCGG
TCGATTCCGTCGTCGTCGGGCTGTGCTGCATCCACCCTCGCGCCTCCAAAGACGGCTCCATTTTGGCCAGAGCGGCGACTCGAAGCATAGCACGAGGGCT
CCTCGGGTAGGACTCGTCCATCCATGTAGAACTCGATTCACGCCATGTGTCCATTTCGTTGCTGTATGACGGGAGCGTATTACCCATGGCCACGAGTCCT
GCTGCTCGCTGCAGGTCTACAAGTGACGGGGTGGCTCGTCGAATGTACTGCGTTGTAAGAGGCACCGCGCCCAGTTCCTGCTCCAGTTTCATGGTGATCG
AGGCACGCATGCGCATGCGACGCTCCAGGTCGAAGCCGCTTTGCAGCGGCAGGTGGTTGGGCAACCCGAGCACGGCCTGGCCGGCCTTGCGCTTCTTGTC
GAGGCGGCGCTGGTTGCTGTTGGCCTTTTGCCGGTGCATCTCACACAGGTTGTGGCGCTCGCCGTTGCGCTTGATGGCGCGCAGGTTCCAGCAGCGTTTG
CTGGCGTAGCGGCACTTGAGCGAGCTGAACTCGTCGTCGGTGGTCTGCATGGACATGGCAATTTTTCGACTGCGGTGGGAGACGGATGTGTCAAGGCGTG
GCAAATTCAAGAGTGGTTGGTACCAGCGTCTTCAAGGTGCGAAAAACTCAGGAACGTCGACTTTGTGAGAGCGCCGGCATTTTTCGGAGCTTTTCAAAGA
CGTAACTGCAAAGGAGCTGATTTGCGTTCGGAGCGAGCAGCCTCCGCGGCTCCGGACGCACCGAGCGATCTCGCTTCACAAGCAGTCGCTGTCAAATCGT
CCCATGGGGGGCATCTGCGTTTGCAGCGATCGCGGCGATCAACAACTCGGTCTCCGATCAGCATGAGATACCTTTGCCACGGTTCCTGCGCGGCCTGATT
TCCCGAATCAGTTTCGGCGGCTCAAGCAATTGGTACTGCACTTGCGAGCAACCGAGCAACGTTAGCGGGCCGTGCCAGCAAGAGCGAGACGCCCCGGAAC
TCGACTCCCGCCAGGAAACGCTGCGCCGCTGGCGAACGGGCGTTTGCTGAATAAGCCCCATCTGATGTCGTCGGCTGAAGTTGCAGCTCGAGCAAGCTGG
CAGGAGAAAACTATCTCGGTGCCTGACCGAATCTGACTCAAATCAGTGGGTTGCCACGAACATCGCGTGAGGCATCTTCCCCGTGCTCTGTGTGCCACGC
AACACTCTCGGTGTCTATACTGGCGCCAGCATTGTCTTTCCTCTCTAGTCGGGACTACCGCACGGTACACGCTGACTCACACTTGCGCCGCACGTTGCGG
TACACTTGCGAACCTTGAAGTGTTGACCATCTTGTCGACCTGCTACAGCAGGAAGGCGAATTGAGCCGGAAATGCCAACGCGTCAACAACGAGAACGCGA
ATAGAGGCCAGATAATCGCTTGTCGTGTTGACTTAGCGCACGCTCGGGCTGGCGAGCATGTAGCGTTCGACTACATTGCACTGTGGTCGGAGTTGCAAGA
GGAAGCCGGCGGCAATGCATTGGATGTGATGTCTCCTCG