Description :
From Genome Similarity Track
Location :
contig_60:216372- 238811
Transcript NameFunction/comments
g10717.t1RAW43636.1 hypothetical protein PC110_g138 [Phytophthora cactorum
g10718.t1hypothetical protein
g10719.t1hypothetical protein
g10720.t1RAW43643.1 hypothetical protein PC110_g134 [Phytophthora cactorum
g10721.t1hypothetical protein
g10722.t1hypothetical protein
g10723.t1hypothetical protein

Sequence
22439 bases(100 bases per row)
GCTTTCACGATCCGGATAAATGTTCTCTGGATTTTTACTCATCCTCTACTTTTATCCGGACAAAAGAGATCTTCAAACTGAGATCTTCACTTTCCAAGCA
GCCACGAACCCGTCAAGTCTCGCTGCCCCACCATCGCAATGTCGAACGAGCTCTTCCCATCAGCGCACTCCAATACTCCATGCTCCTCCGCGCCGCCTCC
GCCGCCACTTTTCCGGTCTACGGGGGACCTGGAGAAGTTGATTTCGCCGCATTTCGTGGCCCCGGAGGCGCGGCTGAAGCCCATTCCGACCAACGAGTGG
TGGGGCAACTTGCTGGCGTGGGACGGGAAGCGGGAGAGCGACGCCGTGTTCGCGGGGCCGTACACGTACAAGGTGGTGCAGGGCCAGGCTGGAGCCATTG
GTAGCGGCCTCTCGGTCAGCTACTTGCTGCAGTACCGCACGGACGGCCCCATCAACGACAATGGAGCTCCTCGCTTCTACTTCTACCCGCCGACTATCAA
GAACTGGATCTTCTCTGCTGTGGAACTGGCGGAGCAATCGGGTACAGCCCCTCTTAGTATCCAAGATTGGGACGATATGGGGGTGCGTCTCGCCATGGCA
GGCATGAACATGTACTTGGCCTTGGGCACCGCCTTCACGACGGTGGAGTATCAGGACATGCAGGTGCAACTTGGCACCGATCATTGCATTGTCGCTATCG
ATGGAGCCCCGGCTAGAGAGGGGCACCAGGTGAACGGAATCAGTTTTGTAGTCTCACTGAATAACGGACAACAGTGGGTGCTCTACTTCTTTTCGAACGC
TGGGGGCAACACCTCGCTGGTGTTCAAGGACAACAAGCTCACGACTACGTCGAAGTTCACGGGAGTCGTGCAGGCGGCGTTTGTGTCGACAAGTGCCGTG
CAACCTGCGGTGCCGCAGGACGACCACAAGATCCTGCAACTTTACCATGCAAGTGCAGGGGTCTACCCGAGAGGAGTCTCCGTCCAGACGTTCGATTCTG
AGTCGTTTGCTTTCAACTGGCAACTTGTGAGAGCCGCAGGCAGCAACCCGGGTGCACGGTTCCTGCACTTTGCACTCACACACCTTCAGGCGATGCTGGA
TCCGTCTACTGCTGAAGCTAAGCACGAGCTTACACTGCACTCGCATACTCATGGACCCCTGTTTGCGTACGCGTTGGTATCTCCGCCAGATTCTAATCCA
ACGTGGCTGTGCCACGTGCTGCAGGCTGAAAGCAAGGGCATCGAGACGTGCACTGCATTTTACCCACCTCATGCCGGCTCGATCACGCGTGAGGTGGTGG
AGAAGCTGAACTTGTGCCGAGTCGTCACAGATGAAATTCATGGGGATTGGTCTTTGCCTCGTGAAGGCAGCTACTACTTCAAGGGCAAGGCGCTGCAGAA
GTTTGGCTCCATGTGTCTTGTTGCGCAGCAGCTTGCTGACACAACCAACCCAGAAATGAGGGAAGTGGCTCAACATGGCATTTCCAAGCTGCAGAAGTTG
TTGGCGGACTTTGTGAACAATCAATCAGCGTTCCCACTTGTCTACGACACAGTGTACAAGGGAATTATTTCCAGCGAAGCCATGGCTAAGAACGACATGA
ATGTCGATTTCGGCAACAGTGTGTACAACGATCACCACTATCACTACGGCTACATTGTGGCCGCGGCCGCCATGGCCCTCTACTTGGATGCGACGTGGCG
TCATTCAGCCGATGCTGTCAAGGTGCGCACATTCATTGACACGCTGATCCGGGACGTTGCTACCTCGTCGCCTGCCGGAAGTGACCCGTACTTCCCGCGC
TACCGCTACTTCAACTGGTGGCTAGGTCACTCGTACTCACACGGTGTGACTCCAATGGCCGATGGCAAGGACGAAGAGTCAACGTCGGAAGAGGTTAACA
TTCTCTACGGCATTGCACTGTACGGCCAAGTGACGGAGAATACCGAGCAGGAAGCGCTGGCAAAGCTGATACTGAAGGTCTATGTGCGTGCGGTGAACAC
ATACTTCTTGTTGCAAAATACTGGACCTAAAATCCATCCGGCGGGCTTTTCAAAGAACAAGGTGACGGGTGTTTTCTTCGATAACAAGTGCGACTACGCA
ACGTGGTTCAGCCCCAACAAGGAGTGCATTCACGGCATCCAAATGATTCCTGTTTCGCCGATTCTCGAAGTCTCTCGAGCACCGAGCTTCGTGCGCGAAG
AATGGGACGAAGTGCTCAGCAAACTGCCGATCGTACACGACTGGAAGGCGAATCAATCTGGCTGGACCTCGCTGCTATTTGCAAATTACAGCGTTCTTGA
TCGAACCAAGGCTTTGGAGGTGCTATCCCAGTGCCCGATGGACGATGGACTCAGCCGTGCTTGGGCCCTGTACTACGCAGCCACCCGGCCGTCACCCCCC
TGCTACTAGCAGGCTGCTAGTCGAACCTCGCACGCAGCTAACCCAGTCAAATAAGTCTCGTGTTTCGACCCCCCATTCCATTAGCCACAAATCGCATCTC
TATCTGTTCATCAAAACTGTTGCACCTCTTGTGGTTTGCCTCTATCATCATGAAGAAGTCATCGCTTGTAGCAGGGATTGAGCCAAGTTGCTTACAGCAG
GCGACACTTGTCGGTCACGTAGCGAAATTAAACAACTGCAAGCCGTGAACGGGTTAGACGATGCAATAAATATGTAATCAGCTGAGCTCGTACCTGTCGA
TGAGACGTTGAAGCTCTGCTGGGGGCAGTGCTCCAATAAAGGCAGGTAGTTTTCCGACGAGGGCCCCCACCACCTTTAGTCCGCTCATTGCAACGGACTC
ACTTTGGGTGACCTCAAGACGAGCTGCAGCTATCTCGAAACAGATGCGAACAAGCTGCAGATCGGCGTTGTTTTCCATGGAGAGCAATTCGCTGGCCTTA
TACAAAAATGCAAAGATGACCTGTAGCAGTAGACACCGCATGAATGAAGATCAGGCGAAAAAACTCAAATGACTTTGGGGGTAATACAGCCGTACCTGCA
GCCCGCCAGCAACCACACCGTCTTCTGAGCAATGCTCGATAGCTAGCGCTACGCGCGAAATGAGTCTCTGTGCTTTCCAGCTAGCGAGCATATTGTTATC
GGATCGGGAGATGGCACTACCAAAGCAAGCAATAAGTTAGTAGCCCACACGGATAAATCGATGATCATGAGACTGCAATTAAAGTGTACCTGAGTAGAAC
GTTACAGCAACAAACGCGGAGTTGGAGAGGTAGATCACCATGTCGAATTTCACTCCATACGCTAACGAAAAGCGTTTGCACGCGCGAGCCAAGCGTCTTG
TGGTCGTCGTCCGTAACGTGGGGTTCATCCTTCGTGCCCCCGAAAATCCAAACTACGAGAAGGTTCAAAAGTGACGAGCCATCCGCTGTAGGCAATTTCG
TACTGTCTTGCTCGCATTCATCTTCAGTAAGTCTGGTGAGAATTGACGCGATGCAATCAATGCACCCGCGCTGGAGATCAATGAGCAGTGATTCATCCAT
TGCGAAGCTTGAACCCGGAGCACACGGGATCCCCAGGATTTTGACCAGCACGACAAGTGCTTTCGAAGTGATATCTCCGTTATACATGTCCTCTGAAAAC
ACCCGATTCAGGTAGTAGACCATTAGCTTGGCCGTCACTAGCCCACATACATCCGGAACGATTTCTTCACTAACGATCAGGGAACTATTTTGCTCGTGGT
GAGGTGTTGCCTCCCGCAGGAAAGCAATCAGATACGCGAACGCGAAGGGTAACACAAGAGGCGGAGGGAATTTAGCTAGTCCCTCCGTAGCGAGCATCTT
TACCTCCTTGAATTCCAGTGGATCCACAACGGAGAAGGCTAGGATGTGAAACAAACGTTCGTTTGTGACATCTCCATCGCTTTCTGGGGCTGTCGCTGGA
TCATTATATCGCTGATGGTCGATATACTCGTTCAGGTGGTCTAAATCTTCGCGCCCACACTGTATCACACAACCACATCAAGTTAATATCAACCTGGGAA
AACAGCGTACAGGAGAAGTTGCTCACCGCCAGCGTCGTAGCACAGTTATATCCAAATATCTGTCGCGGAAGCATACGTAGCACCAAAAACGGGGCCAACC
GAGAAAACAATAGCCCCTCCGTAGCTTTAGCAGCCGAGGAGGATGTGTCGTCAAGTAGGTCTTCACTTAAACGCTGCAAATTCTGCAGCATCAAGTTTCA
AACACATCGATTAGAATTGGGTACAGCTATTTAGTGCTTGCGGCATCGCTCGAAGTTTACCATCATGTGAGCGGTAAGCTGCTTTCCCATCGTCTGAAAT
ACAGCTTCGTCCACCCAACCACACGCCACAAATTGCCGTAGCATCCGGAAAAGTAGCGTATCACGAGGAGAGCCAAAGATTTTGCGAAGGAGAACGCTTA
AGACCTTGCTGCGGGCATTTGCGAACTGAACGTACTTGTTCCACCTGCGCAGCCACACATAGAGCAGCGGTATATTTTAAAAGAGGAACACGGCATCGGA
TCAATACAGCGATGCTCCTACGTACCCGTTTGGACCAAAGCACAGCAAGAGTAACTTTTCTTGTAGCTCTTCTAGCCCATTGTTATCTTTGGTGTTCCCT
TTTAGTAAGAATCGTATTCGTTCCAATAACGGGGAGATCCAGGGGCTTCCGACGAGACCTTCGATGTCTGAAGGCCCCCAGACTGACAAGCATCAACGAA
CCATGTCACCCTGGTTTCCAGCGAATATTGCGACGATGTCGCGAAAAAATACCCAAGCACCGATGTCACTATGAGGTTTTCAGTGTCGTGAACACCAGCT
GCACACAATCCCGCAATACATGACATAGGGTCCAGCGACGGTAAGCAAGAAAGTGCCTAGAGACAAGTAATATGTTAGTCTCCATTTTAAAGAGGAACAT
GTGCACCACACGATGCAGATAGTCTTACCAATCGCCGAACATGATCATTTTCGTTGTCAATGAGACCTAACAGTACCGGTGTAAGCTGGCGCCTGTTCAT
ACAGGAATACGGCGGTGAAATCTTCGTTAGCTTCATTATGAGCACAGGGACCATTAATGTTGTCAGCAAGACTCCTACCGCCAGTGTCGATAGAGCGGCA
CTTGAGTGTCTGCACCGTCCAGTTGGTAAATGAATGTGCGCACGAGAGAAATGATTTTCTACACAACAGACAAAGTGCACAGCAAAGCAAACATATTGTT
AGCATTGCAAAAAATTGCATCAAACATTTAGGGAACAACAATGTGCTCACCCGAATTCTTCGAATGTGAAAATCTTGCAGGTTCACTACGATCTCCGTGA
TGAACAGTTCTCTCGATATGATGAAATCTGCCACAAACAACTCGAGTTCCGTTTGATCTTGTGATCCATTTGCAGTGAACCCTGAGTGAACAGGAACTGC
CAATTCGTTGTCGCAAAGACGAAGTAACTGCGAAAGAAGCTCTTGTTCGTCGTCGTGCGTGGCTAAAAGACCGAATGCATCACTGGGCAAAAGTACACTT
CGCAGAACTTTGAGGATGAAACAAACTGCTGCTTCATCACCTTTCTTGATTGCTGTAGCCATCCCTCTGACGAAAATGAAAACGAAGTACTGTTTCGTTT
CGGTTGATAAGCTCTTGAATGCTTGCGAGCATCCTTTGACACCACCAATAGAGTCCAGCAATATGCAGATGTAGCGAAGTTGGGCATACAGCACTTCACG
ATTGGTTGTGTCGCGATCAGTATTTGGTTTGATGTCCAAAACGCTCAAAATCCACCTCTTCAGAGCTCGAGATAGAACTTCGGACGGCTGATTGTTTTGA
ATTTGAGACGATGCTTCACTACGCGTACACAGCAGTGAGGCGGTTGCCTCCCAGTGCCAGCACATCATATCCAGCACCACTACCTCATTTAAATCTGATC
CAGTTGCGGCCTCCCCATGCTTGGATAATAAAAGCGCATCGCACGCTGTAGCGTACCATTGGAGGTGCTGGAGTGCATAGCTGAGGAACTCACGTCGTGT
TGAGTCTAGATGCCACTGCCGTAACACGGTTAGGAAAAACCGCACGCCTGTCACCATTTTGTGCATCAACTCCTTGCTGGCATAACTTCTCTTTGTTGCT
TCGTCCGACATCAAATAAATCGCAGCAATGTCTCCACACAGTAGCGCAAGTGCTTCCAGGGCAATCAACGCAAGTTTGGACAGCTTCACACGCTGCGAAT
CAGCAACACGACGTACTCCTCGCTCAATAATACCACGCAGAGCATCCATGTACGCTTCAGCTCGATCACCCAGCAGAAACGGGCATTCGCTTCCAGAAAC
AACAGTCATCATCTTCCGACGACGTCGTTGTAGCAACTCGAAAAGTGCAAGACAAGCAGCCAGCTGATTCTGCTTCTCGGCTATCGGCTGGATCCAATCC
AACAGAAGCTCCCGCACAAAGTCATGACTCAAACTCGCAACGGCGCACTCACGATTCACCATCCAGTTCAGCAAAACATGCAGTTTTTCCGCCTGCGGGC
CCCAAATGCAGCAGTTGGTACGAGACGCCGTGCAATCTCGCGTCGCCTGCATAATTGCGGCTGCAGCTACAGCACACACCAAGTTTCGGTTCTGCGCAGT
TGTCCCAACCTCATTTCCAACTTCATAAGCGTCCGCAACCGTCGACTGCAATGTACCACCAACCAACAATGAGTCAATTTCTACCATTTACAGCTTCTCA
CAACAGTTAAAACGCACCAAAGCAGCTTGCAACCGTGCAATCCGCTTGTGGTCCGACAGCGACAGCACTCGACCCTGCACAGTCAATTTCTCCAATGAGT
GAGGCCACCCGCACCACTATCAGCACTACAGTGCATTGTTCAGCCCTAATTGACACCTCTCCAGTGCGTTCCAGCACGTCAACGTCGTCACTGCCACTGG
GTTTGAGTAAGGACTCAGATCTGATTCCATTCTTCACCCGGTCCAGACTTGTGATTGCCGCCTCCATCTACGCATCCACAAGGATTAACTTGCACGATTA
TAATAGATAAAGGGGAGAGTATAAATTTACTGTAGACATACGTGGAAGAGCTCACAGTCCTGTAGCACTCGCAGCAGCCGCCCCGCGCTGTCGCGATCGC
GAGTTCCGGCCGCCATTTTTTTCGTCTTGTCAATTCAGTCACGGTACACTAATCCAGTGTGGTGCACAAAAATATACATATGGCTACAGCTGTGAAGAAG
GGACGGCTACAGTTGAAGCAGCAAAGGATACAGTTGAAAGACACTGGTTGAGCCATTAGCACATGCATTTTCTCATTCGATCGAGATGGTACCAACTCCA
TTTATACATACAGAGCTAGAGCTGGTGGCTTCCTATCACTCGGAAGGTCGTGGTCCTGTCCTGTCGACTGAGGCTTTACAGCGTCAGGGTGTTGGGGTCG
TCTTGGCGGACTTTGTCCACGTCATAGTACGTCGCACTGTCGTCGGAGTGAGCGCTCAGGAACGACTGGTTCGAGGACTGGTTCGAGGAAGCTGATCTCC
TGCGGTGCGACGGGTAGTACATGCCGTCGTTCGTGCTGGTGGTGCTCACTTGGCTCTGGGCGTTGAAGTCCACGCGAGATGTAGCGAAGTTGACCCTCGA
CTGGTAGCCATACGAATCCACCGAGTCGCGCATCGAGAACGCAGACGAGGTCACACCGAGAGGACCGATCTCGTAGCTCTGGCCTTCTACGTCGTTGGTT
TCACTTCCTTCCTCCTCAACGCTAACCACGGTCTTAGATCGACTCTTGAACCAGCCGCTGCTGTCACCATCAAAGCTGTTGTCAGAGTCGTTCGAGAAGA
TCGACATCTTGGCCTGAGGACTGCTACCGTAGCCTTTGCTTTTGCTTTGGTTGCTAGGAGCAGCAGCACCCATTGCGGCGGAGAACGTATTGTCTTGCTT
CACAGCCTGTGTCACGTCCGGACTGGTAGCAGCAGATGACACAACCGAGTCCGAGAAGTTCACGTAGGACTGCTCCATAGGAGCATACGAACTGGCCGAG
GAAGCTGCCGGGGTAAAGCGCTGACCCATAGTCGATGCTCCAGGAGCAAACTGCCGGCGTGCCATTGAGGGTGCTGGCTGCGCGGCTACGACGTCTCCGT
CAACATCCACGTCGTCGATATCCACATCCTTGTGCAGATCGTCCAAATTGAAGCTGTGCTTCCTTCGCGAAGACGAACTACTGATACCAGAGTCCGTACC
GGAGAAAGTGCTGACATAAGCGTCGAGGGGCACAGTCGATGGACGTGAGCCGAGACCAGAACCTGACATCCCCGTTGCGATCGAAGCACCTCCTCTTGAA
GACTGGCCTCGCGATGACGGAGGGCCTCTCGATGACGATAGACCTCCGGCCACGTGTTGGCCCCTCGACGAGTTCTGTCCTCGTGACGATTCTGCCCTCT
TGAAGACTGTCCTCTCGACGATTTAGGTGACGTTGAGTGTCCCGCTTCATCGTCCGTATTCTTCGTACCAAGGTACGCTGACAGCACATCGTACGTCGGA
ATTGGTGCCTCGGGGATGGGAGCAGCAGCAGGGGCAAGCGCTGCATTGCTGATCGCAAAATCATCAGCGCTTTGCGTCGAGTCTCCAAACGAGTACTGTT
GGTTACGAGAAACGGGTGGGCGAATCTTGCCTTTAGAGCGACTGAAAACCGGAGCAGGCTCCGGGGCCGGCTCCAGCATAGGCACGTGCTCTGAATGACC
ACTGCGAGAACTCTGTGTAGTACTGTAGCCAGACATCGCGCTCGTCTGCGACTGGTACTGTTGCGGTTGATACTGTGGTTGCTGGTCAAGCTGTTGCTGC
TGCTGTTGTTGCTTATTCTCATACCAGTCCACGCCGCGGCCTGCTGGGGTAGTCTCAACTTGCTCGTAGTTGCGAGCGTTGGTGGACGTGTGGTTGCCGA
ACTCGAGGTTGATGTCGGTGGCGTCCAGGCTGGAATTTTCCTTGCCATCCTTCTTGTGACGACAAGCAACGATCATCTTGTGGATGATCGTGTACGCTTG
ACGCACGAATAATAGGAGGAAGATGAACATGTTCACACCGATGATGCCGTACGCCACATTGTCGCGCACAGTCTGCGGGAAGTAGTCATCTCTTGCCACG
ATGAGCATGAGGCAAATGAGAACGACCTTCATGAACACGGACGTAATGCCGATGTAGTACAAGAACCGCAGCAAGTTCGGCTGACGAATTAGCAGCAGGA
TCAGGTACACCATTGTGATTGCCAGGATGCACAACAGTTGGGTCGTGGCATCCCGAACAACGCCGACGATGGCGCCGGTGAGCACTGCCAGCAGAATACG
GGGGATGAAGAAGAAGCGGTTGTCGAAGTTGTACTCGTCGTAGTAGACGCTGTACTTGCTGCTGAACGCTCGCTGGTCATGCTCGTACGTTCCGACGTCC
TTGAGCTCGTCGGTGTTGTTGCCAACGACGATAATACCAAGTCCAAGAGCGCACAGCACAACAGCGACAAGTGCAACGATGCCGAGTGCGAAGCGCGAGC
TAGAACCGCTTGCTGAGTCGTTCGACGACCCCTCCGAGATGAAATAGCTTCCTGCCATGGCAAACATGTACTGCGCTAGCAGCAGCGCCAGCACGCCGGC
CCAAACGACCTTCCGATACCACTTGCGCGCCACGTCACCGAACGATTCGTTCTTGGCCAAGGCGCCCGTTATCAGTACGATCACCAGGTACAGAGCGTGC
ATCGCCGCGACTACGATGACAAACGTCACGAGCGTGTAGAAGAAGAGGTCGTCTGCGTCCACGCCGATGAGAGCCGAATATCTCGCCGGGCCTGACTCTC
CAGCAGCCGCGACGATGCCCGTCGAGCCTGAACCTGAGTCCGCGAGTCTTCTTGTGCCATTGGTACTGCTGCTGGAGTCGTCACTGCTCCCCTTAATCAG
GTTAAAGTTGGTCCACGAGAGTTCCTTGGAGAACTGCAACAAGAATGTCGGCGCTCCCTCGATCCGGAGCTGGCTGATCATGCCTGCGAACTGTGCCTGC
TCCACGATGTGCGTCATCTCGTAGAAGCCTCCAGAGAAGCTCAGCGCCGCTGCAGCACTGGGCATTATCGAAGCCCAGAGCATCGAGCCCGTGCCAATCA
CAGCGGCGCCCGCCAGCGAAGTAGCAATGACGCCCGAGGCCGTGGTGCCGGCCTGCGAGTCCAGGAAGTGCCGCGTGCCCGTGGAGTTGGTGGGCCACTG
CGTGTTACTGCCGAAAACACATCCGGAGCACGAGTTGGCCTCGACGTAGCTGGCGTTCAGGGCGCCGAGGTCCACGTCCGAGGCGAGGTGGAGCGCCTGG
CGGATCTGCTCCTCGCCCCACGGGATGGCGTACGTGTAGAAGAGCAGGCCGAGCGCGGCCAGGAAGGCGAGTGGCAGCAGCAGCGCGCAGAGCTGCGAGA
TCGCCATGCAGCCGCAGCATTTGGCGGCGCAGCACAACAGCCCCATGACTACCGGTAGCTTCGGGGTGGCGGGTGGATTACCAGTATACGAGGGCGGCGC
TCGTGGTGGTGGACCTGCTGAAGCGGAACTGGCTGCCGTTGATGCGCTTGCCTCGGTGGATGCAGAGGCGAGGGGAAGAGCCTGTAGGAGACTCGCCCAA
TGCACAAAAGTCGGATGGGACGCGAGGTTAGAGACCCGTGTCAAAGTGCAAGTGTTCAGCTCGAACAGCTCAATCAGCTCTCTTCAATATTGACCAATGG
AAGCACGCGAAAACGATTCAGACCGTTTCGGTGAGTGCACTTTCGACCAATGGGAGTATGAGACAGGGGTTGTCAAAACAACCGTACATGGAGGCTTCTA
GCACGTGCATGGCACGACATTTGTTGGCGCGAAGAAGGCTTCCACTGCATGTACTACATGTAACAGAATCCTTCTTCGTCCTTTGGACAGTGTGTTGAGC
GTGCTGTTGCAGGCTCTGATAATCGAAAAGCACGATCGTTTGACGTACGTGATAGGATACATATACGGTAGCTTTCTGTGCGGACTTTTACTCGAAACCA
CTTCTCTTCTACCGAGAGCGGAGTTTGCTTTGTGTTGGTGAGTCTCCTTTGCGTAGCTTTCCTGGGCGATGTGGGGGTGAAGAATACATGTACGAAGCAC
GCTGACGGCGAGAAAAAATATACCGCGCTTCGACAACGTCATGTCATGCGGCGACGATGCTTTGACTTTGATTGGTACCTATGTGGTTTACACAATGCGA
TGTTCTAAATGTACGTTTATCCATCAAACCCGTTTCTAAACTCATTCGATCGTTTCTAAAATAGACTATGGCCAGCGCGACGCACCCGTTTGAATGGTAC
GGCCGTGCACCGACGCCCCTAGCGCTCGCTCCGTGCCGCCTTCTCCCGCTTATCAAAGTTGACATTGCTCTACCCGTTCTCTTCTTCCCAGCGAAGTCAG
TCTCTCGTTCCCCGCGGCTGTGGACGCGCAGTACGTGTTGCAGACGCTCGAGGTCGACGATGAGCTGCAGCCCGACAAAATCCACCGCACACTGACCGTC
AAGGGCACAGAGCTCCACGTGTACGTATGAGGCTATTGATTCCGTCTTTGTCTGAGGTTACTTTGTGGTCTATTGGTGCTGACTTGTTTGTTGTTTGTTG
TTTGTTGTGCGGCCGTTTGGTTGGTGGTGGTGCGCTGCAGCCACTTCGAGGCCACGGAAATCCGACTGCTGCGCGCCGCCGTGTCTTCGTTCTACGACAT
GGGCGTGCTTGCCGCACGCACGCTGCTGGAGTTTAAGGAGTAACCGAGGCAAGAGGAATAAAGTACTACGTCTGGGTTGACCAAATCCGTTTCGGCCCAT
TGGGAACTGCCTCCATCATGCCCGATCCACGCATCAAGTGCTGACAGGCGTCACTGCTTGACCATGGCAGCAACGAGTTAACCTCATTTTCCGTTAGCAA
CGACTTGGCGCGTTAATTTAACTGCTGGTGAGGCATCTTCAAACGGCAGGCCAGGAGTCTGGTTCGTTTCGACAGACGGTTTGGTTCGCAGCAACACCCC
TGAGTATCTGGTAGAAGCTTCCAGCAAGTGGAGCGCCTCTCTAGTGTGGCCACGCGAATTCACTCAACCGTGCGATAATGCATCGTATCACTGCGAGCAA
TTGCTATCTGGAGCAGCGGTTGGACATTCCATTCTGCTAGTCGCGGGAGCTCGAAGACACAGAATCAAAATGTCAAGTGTAGCAGCTCGTGAAAGTGGTT
CTGGTGACGAGCATAGCGTATCAAGCGTATCAAGCGGGGGTCAATTGCTGCGGGATGGAGTCCATCTGATGGACCGTTGTCCACTACAACACAGTGCTGG
CACCTGCGACAGATGCAAGCAGAGAGGATGGATTTTACTTGTAGAGCAGGAGAGGATGGCTTGAGGTTTGCTTGCTTTTGGGATGCGAGCCGACACCGAT
TGCTCTTCGCCGTGTAGTGTGGGTCTCTGTACTTGATCACTGCTGTCCCACGCCGAGACTACTGTATAGGGGGCGGACAAATCCAAAGGCTCGCCCCAAA
CGCTGCTTTGAAGCACAGCGGCGGTCAACTTCCCGACATGAAAGGACGACCGCAACTTTGCTGGGGAAAGCATGGTGGGGGCTAGTGCTCCAACGCGATG
ACTTCCGTTGATTCCGTTGGTCTCGAGGCTCGGTGACGTTAAGCGCGTAGTGAGCGCTGGTTTCGCGGTTTTTAGCCGGTTTCCGGTCTCGTAACGGGGC
CAACAACTCCATGCAGCATTTACGCTTCATTTCTCCGGACGCAGAACTATTCCTTCCGGTTGCTCTGGCCTCACAGCCAAGTGAACCCCATGGGAAGCAC
CACACAGCTCCATCTCACAACTCAGGTATGGGTGCAGTTGAGACGGAGATTGCCAACTTGGAAGCGATCGCCGTTACCAGGGGAAAGCAAAAGCAGTCGG
CAACGCAGACAAATGTCCTCGTGGTTGGAAGGGGGGGGGCTGCGTGGCAATCGTCCTCGGCCGCTGCCGCTGGGTGTCGTGCACATGCGGACGGGGCTGG
AGACGATTATCATCTTTAACCCTTTCACTCGCAGCGCGCCACGTTGTTCACTGAACCTTACGAGATTCGCAAGGTGTATGTACATACAACGCTGGGTGTC
TGGATCCCAGCGGTGGTTGGAATGTGACCTGCCACATGGGACTTCCGAAACAACCGAAGCCATCGCTAATACCTGTACCCAACAGGCGCCCGCAGCAAAA
CCATGTCGAGACGACCAAGCAGCTGCCGTTTTTCTGAAGCCGTTGTGTGTAACGTGCAAGTTGTCGGCAACTTGTGTCACCGAGACACGGGCATAGCCAG
CCGTCGATGTCCAGCAGGCGGGTTTCTGGGCTGTGCCCAACGTCCCTCTCCTGCTTATCCTAGCGAGTTGAGGTCAGCGTGGCGGCAGTCTTTCATCACT
CGCCAATCCGCCCGCTTCCAGAGATTCACCGTCCACCTCGGGCTGAAGCATGCCGTCCCTCTTCGTTGACGAGCTGGCTGTTGACACCCGAGAGCTCGTG
GAGCGGCACGTGGCCGAGTCGTTCGCGAGCCACCGCCCCGTGTCCTTCGACGACGCGTTGTCCCGCTCGCATCACACGTTGCGCGGTCGCAACTCCATGC
CGGCAGTGCTGCGACTGTCGTCGGACTTGGGCTCCAGCCGCCTCTCGAGCTTCGGCAACATCCCCGGCCACGAGGTCATCGAGACGTCGGTCCGCTTCGT
GGGCGTCACCCGAGTGTCCACCCATTGCGAGTTCCGGCTACACGTGGACACTGGCAAGGAGAACTTCGTGCTGCAGAAGCGCTACTCGCAGTTCCGCGAC
CTGCGCCAGCAGTTGCTGCTGGACGGCAAGTCTGCTGCAGCGGGTGAGAAGGGACGCAGCGGCCAGTGCCGCAGTGGAGCGTGTCTGCAGCTCGCGCAGC
AACTCGCCTTGCTCAAGTTTCCTCGACGCAAGATGAAGTTCAAGCTGCACCGGGACGACGACGTCCGCATTGCAAGAGAACGCCAGGCTCAACTGCAAAA
CTTCGTCGAGATGGTGCTGGCAGTGTACCGCATGGCGCCCAAGCGGCAGGTGCGTTGCTGCGTCAACTCGCAGTGTCGAGTGCTCAAGGCTATTCGATCC
TTTCTAGACATTAAGGATTTGGGCGAGGACCTGGTTCCGGACTGGAAGTCGGTCAGCAATGGCAGTAGCACCGGTGGTGACGTGCCGATTCTGGACACGC
CGCCGTCGACAGGGGGGACCAACCCGTCACCAGTTAGCACGTCGTCCAGCGATGCTGCTGGCTCAAACGGCTCGCCGATCCCCGCGAGGACGTCGGCCAT
GTGCTTGGAGGAACTGTACACGATCACAGAAGACACCGAGCACGCCTTCGTCTAGACGATGTAGCACGACATAAGGACGGATGCAGTCCTAGCGTCGTGG
ACGCGACAACCAACCAACTCACCAGTCGCCATCTGTAGTAACTTATTTGCTTCGTTTGTAGCACCCGCTCCATCGGTAATTCAAGAAGATGTAGCAATGG
AATCCCATTAATTTACCTTTGCACGTGAACACCTTTGTTCGAGTTTAGTGTTCCACACCTTTAGCCTTGAGCAATTCTACGATCACTGTTGAGACTTTGT
CCTCGTCGTTGCTCAGCCCGCCCATGATCTGCGAGGTCTTGCCCCACTGGACGTTGCTCACGAGAGCCTACAACCAGCAACAGCAGGTGTGTCCGTTAGC
TCAGTTGTGCTTCCTGTATCCGTTAATCGAAAGCGTCCAACCAGTTGATCAGTTACCTGCTCATGTTTGTTGTCAGTGGTGCCCCGGCCACTCAGACTCG
TGTTGTCGCTGTCCCCGGCGCGCTGTCGCGCCCACTTCATCAAGTTGTGATTTCATGGACATACCAGCACCCGATAATGTAAGACATGCCAAACTCCTCA
TCTGAAAAGCATGAAGTACGTACGCTTCGCCAGCTACTATCGTTTCCACGCGAACGACGCGGAGAGGGTTTTGGTTTGTCGATTATTGGCTTTTGCGCTC
GTCGTAGTTGGCCACAGGAGACGCCCGGAACGCCTCGCTCGGTTTGAGCTCCTCTGCCAGACGTCGGTGATAATGGCAGCTTTGGCAGACAGAAGTTCGG
CTCGCGTACTGATCGATAGCAACCAAGATCTGGTCGTGGTCCCATGGTTGGAATGTGCTCTTCCTCGTGTCTAGTGAGAACAGTGTCCACCAACTCTTGT
TTGTACTGGTTCCACCTCGCCTCCCTCCGCAAGTCTCGCGTGACGCTGGAAGTATCAGCACGCGCTGAAAGACCAATGACTTCCTGGCGCAGCATTTGCT
CGGTGGTCGCGTCCTTCAGCACAATTTGTCGGAAATCCACGCGGTCGACACGATACAAAGTGGCCGTCGGTGAGGAAACCAAGACCGAAAACACCGCGTT
CGTCACACCAAGGGTAGCCTCGTAAAAGCCAAAGTAGTGCTGACTTCACAAAACGCAGTGCGAGGGTCAGTATGTTAGATAAGCTTCGCGTCGAGAAGCG
GTATTACTACCTGCAGACGGTCGATATTTCAACAATGCATGGCTGCTTGCGGCTGTCGTGCTTCTTCTGGTCGAAGGCCGAGTAGCGTTTGACCAGCCTG
CACTCACCATGCTTGATGAAATAGAAGTTATCTTCGGACGAGAACCAGCGGAGTTCAGATCAAAGGCAACAACAGAAATGAGCATCACGTTTACTTACTT
GCAGGTTCGCCTTCCACAACAATGACATCGTTGTATGTGTGCTGTATCTTCTCCATTCGGTCACACAGCTTCAAGATGCCTTCGTCTTCCCAATGATCCA
GGCAGGCCACACCTGCTAAGAATGTCATTTTCTCGCTGGCAGCAAAGACGACAATTTTGCAAGTTAGCTAGTCCACGTGATTGAAAGTTGCGTAAAAGCT
CGTACCGGAGGTCACGCGACAGATTGCACGCGCGTAGTGCCATGAACGTGTCACGATCAATCTGCATGAGCAATGTGGTTTCCGTGGCCACAACCGAAGC
GGTACGCTGTTGCTCTTCAAGGAGCAGGCCAACGTCGCCGAAGACTTCCAGGGGCTTCATCGTGCGCACAATGTACGTAGCATCATGTGACCGATCGATC
TTTCCGCCTGGGTTCAGGAAGCTGGAGTGCACGCGGGCTCGATTCATGATCTCCTCGAACTCGTTCAGCGTTGGGGCTGCCATTCGCGAAAAGTCCATGA
CGACGCTCATCGTTCCATACATGATGCAGTAGAACGCATCTGCACGATCACCGATTCTGAAAAGCGCATCTCCGTCCTCAAGCTCGATGCCTTTGGCGGC
CTTCAAGAACCGTAGTCGGTCTCTCGGTGGCTGCTCGCGAAAGTACTTGACGCGTTGAACTGTACAGCACAACAGCACAAAGTCAATGCAAATAATGACA
AGACGTCGGCCGTGAAATTATCTGTAGATACACCGCTTGTAACATACTGTATTGATCGAGGAACTCGTAGTCGGCCTTGCATCTCGCCACTTCGGACAGC
AGAAGAATTCGCCTCAAGTTGGCTCGCACCTCCGGAAGTTCGTGGTTTAGCTGCTCCTGCCAGCTCGCCCTCTTCGACAACCTAGCAATGGTCACATCGT
GTCACAACATACTACCAATATATGGTACTATCGGCTCTCTGAATGCCAGGCATACGCACATGCTGCGCGGCTTGGCGAGTTCAAGTGGACGACCAAGATG
TTGAAGGTAGTAGCCATTTAAAATTATAAATGGCTACATGTACCTAATATAGGCGTCCTATGCTAGGTTGTCTTATGTCATCCACACTACTTCTGAATCT
CTTTTTGTCGACCACTTCACTCCCACACAAAGTCGAAAGGTGAGCACGACGTCACATGGACGCATCTGCTGCCTGTTCACGCTTGCGGATGCGCTCCCCC
AGCGCCGTATCGCGCGATACAACAACTTCACCACGTATTTATCCCTCTCACATACCTGCTGGTGTCATTTTCACGCAGATTCTCGCCGTCTATCGCTATT
AAACTCCCGCCTAACGAACACCATGGACCCCGAGACCAAGAAAAAGTGTTTGGACGTCGTGGAGCACTTTATCAAGCTCGATAGCTGCGGTGTGTTGCCA
TTTCTATTGAATTAGGCTTTTCCGGACTGGTAGCAATAGACTCACGCTTGTTTCTGTGGCTCCAGAGCCCTTCCGCGAGCGTGTCAACTGGGAGGAATGG
GGTCTGTACGACTACCTGCAAGTGGTCAAGGAGCCCATGGACCTGGGTACCATCCGCAGCAAACTGAGCAAGAACGAGTACAAGAAACCGGCCGAGTTTG
CGCGCGATATGCGCCTCGTCTGGCACAACTGCAAGCTCTACAACCAGGACGGCTCGGACCTCTATCTGCTGGCCGATGAACTGACCAAAAAGTTCGAGGA
CCGGGTCAAGACCATGAAGCTGGACGTGGGACCGGTCCCCAAAGCGGACAAGAGCATCCCGTACGGTACATTGATGTAGCTTTGATGTTTTAGTTGGTGA
GTTTTAACGTGGTATGTGCTGTTGAGTAGAGCCCCGAGTCTGGAGGAAAAGATTCACTTCAGCCAGAACATCTACAAGATCCCGAGCAAGGATTTGAATG
CAATTATCGAGCTGCTGCAGGAGCAATGCCCCAAGGCGCTGGACAAGAGCTCGCCCGATGAGCTGGACATTGTCGTCGACCACATCGACAACAAGACGTT
CCGCGACTTGGAGAAGTTCGTTCTGGAGAAGGTTCCTGAGGGCAGTCGCGAGCCGATCTCCACGCCCAAGTCGTCGAAGAAGTCTCGACGGCCACCGAGC
AAGAAGACGAAAACCGATCCGTGATCGAAGATGAATGCGTTTTGAGCGTGCCTAATTTGCCTTGACTTGTGTTTCATGCTATGCCACAGCCTTTCTGGAT
AAAGAGAGAAATGGCGCGTGTATTTAACCTCATCCAGGCACGCAGTGAAAATCGACCGTCTACTTGGACGGTATGACGGCTTATCAGGGTATTTAGTCAT
CTTTTAATCCCTTTACGCTTCTTCCCTGAGTATTGCTGCTCTCATTGCGTTATTTACTTCTTCTTTCGAAGCATAGTTGCAAGCCGTGTCTGCCGTTGGA
ATGTGGCCTCGAAGCTCTTTCTCTTCTGCTTTTGTACGGGCTCGTCAGGCTCGTGTCGAACTACGGCAGCTGCTGGCCTACCGCCGAGCCTGGTGAAGTC
TAGTGGTGGCACAACGATATTCTGCGCTGGTGATGCTTCATCAGAGTCATCTCTTGGCAACCCAAGCTGGACGGGAATTGCTGCTGAAAGGCGAGCCCCT
GCCTTGGCTCGAGTGGATTGCCACTGAGGTGGTATGAACTTAGGTCCATCAGGCTTCAGTGTTGCCCCAGTGCCGTGTGAGGCACTTGGGAGTGGAGCCA
CTGGCTGCAGTTTCGGCAGCGGGAGTTGAAACTTTGACGGACGGCGCATCGTTTTCCTCTCGTTCGTCGTGAAATCCCGCGCTGTGTGTTGACGACTCGA
TTCGGGCTGGTATTGGGACGAGCGTTTGTACTCGAGCAGTTCCTCCTTGTGGAGCTCCATCAGCTCTCTAACCACCAGTTGAGAAGGTTGTGAAAGGTAA
TATCGCGATCTCAAGAGTACGCGACGACCAGAGAAATGCATATTACCTGAGTGAAGGCTCATTGCTGTTGGCGGTGTTCCAGTTGGTGCCGTGAATCTTC
TTGCCGGCTTTCATGAGCCTGGTCCATTCCTGCACAGCAAAAAGGTCATGACGCTGGACGATGGAGGCCAAAAGCATGCTCAGCCTTACCTCCTCGTCGT
GCCGACTGGTTTCCACTCTGGACGTCACGATTTCTTCGAGTTCGTCATGATATCGCAACTGATCCTCTCGAGCAGCGAGCTGCTCTTTAAGCTTGCCGAT
ATATCGTCGAAGATCCTCCTTACGTCTGCCAAGCTGCTCAAGCACGCCTCTGCTGGACTGTTGAAGTTGCAGTGGCGGGTGATATTCTACATGGAGTTCA
CGGCAACACTCTCCTGTTACATGGAGCGAGGTGGTACAAAGTGTTCATTTCTGCGTACGCGTTCGTCGCTTGCGTTTTTGCATCTGCTGCTGGAACAAGC
CCAGGACGAGCAACAGTAGCAGCACGCAGCCGATGATCAAGCCAGGCGTATCGATCTTCGAGCCTGATGCGCCTCGAATTTGCGGCATTTCGCTACTTCA
GCGCAGCAAGGACATTGACAATGTGTCCTGCATGATCAAGCCGTATTTTTAGGCAAACCTCCGCGATTTCTTATGACACGAAGTGCATTTATTTCGACTG
GGGCTGAATTGGCGTCCTAAACTGTACAATAAGATAAATAGGAGCACGCAACGCAGCTCACACGTCCGCGACGAACACGTCTTCATCCACAACGAAGGCC
GACGCGTCGAAGCTCGGAGCCGGCTGGTCAGATGACGTCGGTGTGAGCCAGTAGTCACTGAAGTCCAGGTTGTCCCAAGTTCTCCCACGTCCACGGGGGA
TGTCTTGCCCTCTGGCAACGCGGCCAGCGCCTCAAGTCCCGTGGCATCGAGGCATTTACTAGCGTCTCCCTGTCCGTCCTGAAGGATGCGATCCAGCACC
TCCTCGTCCACAGCATCAGGCAGTCGCTGCAGCTCCAACAGCTGTGCGTCCTTGGCCTGGAATCCGTCGAAATGGCCGCCGTCCAGCAGACCTAGATCCT
GCAAGAACCAGCCGGTGGGCCCTGAGCTTGCACTGGAGGCCTGCTCGGCCTGCTGCCTGGCACGTGCCTCCTCCTTCATGGCCAAGTGGGCGCTGAGCGG
GGCGCGTCGCGCGCGCTGACGCGTCTTCTTGCGCAGACGCTTGCCGGCAGGCTCATGGTCCGCGGAGGCCTGCGCTCTGGTCTTGCGCTTGAGCTCGAGG
CGGCGCTGGTTCTTGTTGGCCTTCTGCCGGTGCAGGTCGCATAGGTTGTGGCGCTCGCCGTTGCGCTTGAGCGCGCGCGGGTTCCAGCACTTCTTGCTCG
GGTAGCGGCACATGACCTCGGCGTCGTGCGCGGGCGAAGGCGAGGGCGAGGGCGTTGGGGGCTTAGGAGAGGGAGAAGCTGCGCCGGGGCGGGTGGCCAT
CATTTCTGGAGAGCAAAAGGACGAATGATCTCTCGCTGGCCACGCACCTGAGGCTGCCGGAAGATCCCAACTGCTCCAAATCGGATATGATGGCTACGCG
AGCCATTTGGGTGAACCAGATGTCGGTGCAGAGACTCAACCCATAGTGAGCGTCAATGCGCGTGGATTTTTGCCGAAAATCCGCGGACAATTCAAGTGAA
GTGACATCGGTGCCACCTTCCTGCACGCCCGGTGCGCCATTGACTGCCGCGGCAGCTCCGAGCGGTCGAATACGTTTTCTGCCCTGCTGACTGCAGCGGG
AAGTGGATTCAGCAGGTTGCTTTGCAGGTTATCAGGCCATGCGTATTTGTGCCAGTTGGGACAGTGCCGGCGGTGCGGTGATCAACTTCGCCTGCGCCGT
CGGGTAATCCCTCGACTCGGAATCCACGGCGGAATTGTCGCTGCAGTTTGCGGTTTGCGCAGATCAACAACAATCAGAAACTCTGGACTCTTGTTCAGAA
ACCGAGAGATTTTCGCCCTGCAGTTCTCTTGTGTTTTCGCTGCTCGTATCTTCGTTCTCTTCCACGTGGAGAAGGTGTTTGTGTCCATTCACTTTAGGTT
TGCTGTAACTTAAGGAAATTCTTACTTGTGGCACTGCATTCTGGCGGCTTAAATGTTGGCACGGGTGACGAGTGACGGTGCTCGCCGGACGTCCGGCTGC
CACGAGCTCTGCAGCGTCGCGGAGCTCATGAGCCCTTCTCCCGATCGAGCTACAGCAGTGGCAATAGGTGGCAGCAGCAGAGTCGGAGCTGCAGCAGCGG
TCGATTCCGTCCTCGTCGGGCTGTGCTGCATCCACCCTCGCGCCTCCAAAGACGGCTCCATTTTGGCCAGAGCGGCGACTCGAAGCATAGCACGAGGGCT
CCTCGGGTAGGACTCGTCCATCCATGTAGAACTCGATTCACGCCATGTGTCCATTTCGTTGCTGTATGACGGGAGCGTATTACCCATGGCCACGAGTCCT
GCTGCTCGCTGCAGGTCTACAAGTGACGGGGTGGCTCGTCGAATGTACTGCGTTGTAAGAGGCACCGCGCCCAGTTCCTGCTCCAGTTTCATGGTGATCG
AGGCACGCATGCGCATGCGACGCTCCAGGTCGAAGCCGCTTTGCAGCGGCAGGTGGTTGGGCAACCCGAGCACGGCCTGGCCGGCCTTGCGCTTCTTGTC
GAGGCGGCGCTGGTTGCTGTTGGCCTTTTGCCGGTGCATCTCACACAGGTTGTGGCGCTCGCCGTTGCGCTTGATGGCGCGCAGGTTCCAGCAGCGTTTG
CTGGCGTAGCGGCACTTGAGCGAGCTGAACTCGTCGTCGGTGGTCTGCATGGACATGGCAATTTTTCGACTGCGGTGGGAGACGGATGTGTCAAGGCGTG
GCAAATTCAAGAGTGGTTGGTACCAGCGTCTTCAAGGTGCGAAAAACTCAGGAACGTCGACTTTGTGAGAGCGCCGGCATTTTTCGGAGCTTTTCAAAGA
CGTAACTGCAAAGGAGCTGATTTGCGTTCGGAGCGAGCAGCCTCCGCGGCTCCGGACGCACCGAGCGATCTCGCTTCACAAGCAGTCGCTGTCAAATCGT
CCCATGGGGGGCATCTGCGTTTGCAGCGATCGCGGCGATCAACAACTCGGTCTCCGATCAGCATGAGATACCTTTGCCACGGTTCCTGCGCGGCCTGATT
TCCCGAATCAGTTTCGGCGGCTCAAGCAATTGGTACTGCATTTGCGAGCAACCGAGCAACGTTAGCGGGCCGTGCCAGCAAGAGCGAGACGCCCCGGAAC
TCGACTCCCGCCAGGAAACGCTGCGCCGCTGGCGAACGGGCGTTTGCTGAATAAGCCCCATCTGATGTCGTCGGCTGAAGTTGCAGCTCGAGCAAGCTGG
CAGGAGAAAACTATCTCGGTGCCTGACCGAATCTGACTCAAATCAGTGGGTTGCCACGAACATCGCGTGAGGCAGCTTCCCCGTGCTCTGTGTGCCACGC
AACACTCTCGGTGTCTATACTGGCGCCAGCATTGTCTTTCCTCTCTAGTCGGGACTACCGCACGGTACACGCTGACTCACACTTGCGCCGCACGTTGCGG
TACACTTGCGAACCTTGAAGTGTTGACCATCTTGTCGACCTGCTACAGCAGGAAGGCGAATTGAGCCGGAAATGCCAACGCGTCAACAACGAGAACGCGA
ATAGAGGCCAGATAATCGCTTGTCGTGTTGACTTAGCGCACGCTCGGGCTGGCGAGCATGTAGCGTTCGACTACATTGCACTGTGGTCGGAGTTGCAAGA
GGAAGCCGGCGGCAATGCATTGGATGTGATGTCTCCTCG