Description :
From Genome Similarity Track
Location :
Scaffold_30:21637- 24275
Transcript NameFunction/comments
g9660.t1XP_009530248.1 hypothetical protein PHYSODRAFT_334673 [Phytophthora sojae

Sequence
2638 bases(100 bases per row)
CCATTGGAGCTTCATCCCAGATAATCAGACTGGCATTAATGATCAGCTCCGCCTTTTGACTCTGGAAGGAAAGACTACAGGTCGAATGCTCAGTCAGCTT
GAGTGGGATACGAAATGTCGAGTGTGCGGTGCGTCCTCCTGTTAACAAAATCGCTGCGATACCACTGGAAGTCACGGCAATAGCAATCTTCCGTTGCATC
CGAACGGCCGCAAGCAGCTGCTTCAGCAAAAATGATTTTCCCGTCCCACCCGGACCATCCAGAAAGAACAACTTCTCACCTCCAACTGGGTGGCTGACAG
CCTGTAGCACTTAATCGTAAAATTGTCTCTAGTTGTCATTCAACGCAACATGTTCAAGTTCGTTGTGCGAGTACGCATCCAGTTCTTGCTGTACGACCGA
CGCCGATCGACGGTGTTCCACCTGTAGAGACACGTCATCGTAAGTGTCGAGCCCGGGAAGGCCGTACATATGCAGCGTCTTGCCATTCGCGGCCAAGTAC
TGCTCCAAGAACTGTAAGGTTTTGTATTCCCCCCTTCTCAATCAACCCCCTCCTCACGCTCGATATGGCTGATTGTGTCGCGATCCTCCAGGCTTATGAC
GTAGTCCTCCGACATGTGAGTTTTGAACTTATCCCAAAGATTGTCGGCGCGAGTAGGCAGCGAGTGCAGCAGTATAATTGTGAATAGCTGTCGCAGTTGG
TACGGCATCTTGACAGCAGCCGCCTCCGTTAGGCAATGTACCCACTCTTGATCGTCCTCTAGATATCCTAGCGCAAACGCAGCATCCCGAAACGTGGGGT
AGGTGGTAGCACCAACGGTACGAAGATCAGCAAATGACGTAGGAGAACGCCGGTTACACAACAGAAGTCGCAGGTAGAATCGATCCGGATCTTGGGGCGA
TACGTGAACAATGCGATCCAGGGAGGCCACGTGTTGCTTGTATGGCTTCCACCTCTTGTCCACCCACCTGTACTTTGAAGGGACATCCTTGTACAACAGA
CCAGCTGTCCCATCGGGGCCCCGCACACAGAGTCTAAACAACTCTGTCAGCATCGTTCTGTCTCCTCTACGAATCAGATTGTGAAGCTGAGCAGTAGATG
CATAGCCCCGATACACGACCATGTTCATGTCCTCCAAGTGAACCGGGAGGTTGACGACTGAGTGTGTGGACCCTTGCATTGGATGCATAAACAATCGATT
ACACGCCTCCACCGGGGAAATGTAGCGTCCTAACAGGTACTGCAGAATCTCGTTGGCTTCAATCTCCTCCCCATCAATCGTAATCGTAGTCATGTCAGAC
CCTTTGTAGACATATTTGTAGATGTGCTTTACGGCCGTGTTTGTAGCGCACACCTCGACGTTGATATAGCAGTTGTACTTCTGCGAGAGGAACGAATTGT
ATGGTACAACCCACTGGTTAATGGTCGCCTCGTCCCAAACTTTGCCTTTGTGGCAAAGAATTCCATCAGGCCGGCGTCTGCGCCTATAGTTAGGGTATTT
ATCTGCAGCCATGATAGTGTCCTCCGCCAGCGGCCTTGGAAACTTCTTAGAGCATTTTCCGTTTTCCATACACGGACTGTCAGGCTTCTGTCGACCACAT
GGTCCGTGCAACATACTCGACATCACCGTCTCGTAGAGTTCAGGATACTTCTCTTTATCAGGGATCTCCGCAGATACCAATTTGTTGACATCCTCTGGGC
TCACGGGCTTATCCTCCGATCTCAAAATGAGAAGAATGTGCGCGTGAGGAAGACCGCGCTTCTGGTACTCCACCACATGTGTCTGGGCTGCTTGAATACC
CAAAATTCCTTCATCAAGATCTTTGTTAAGGGCTTTCAGCCTCTGCATGAACACACGCGCCACAATGGCTGGTCTGTCGGAAGCCTTATGTCCGGGCCGA
CGATTCTCCTTAATTTCCGGCCAGTTCGGGTTACATGTCATAGTGATAAACAGATTTGGAGCGCCTGTCTCTCTGACGATAGCCATAGCGTCCAAAAACG
ATGATGCATGTACCGAGGCCCCCTGGTGAATTTGGGAGGTATAATGATCTTCCGCCCGATCTCATCAACCCCTGCCGCCGTCGATTCATTCATTATCCGA
CCGGGTTACCTCCCGGAAATTTGACCGAGCCTCCACTCGACTTACCTCTTCATCTGCAGCCATCCGATGGACCTCGACGGATTCGTTTCGCAAGGCGTCC
GGAAGTCCGTGGAGCGTCTCTAATCGGTATTGGAGTTGGTTCTTCTCAATATAGTGCAACAGTTTTTGCTCACACTTGGCCCATTGATCCACACAGTACT
GCTGCGTCAGCCGTCCCCGACGAAGAATTAGACTATCACTTGCCGTCCTGTCGTAGAGGATGTAGGCCTCATACTCCCGAAGCGATATTGTTAACAGCTT
ACCCTGCGAGTCGACAGGGCTACCCACATACGGAAGGTCGTAAGACCACCCGCGTTCTCCGTACGGGAAAAGAAGAGGGTACTAAAGGGGGTCATAGCTC
TCACTGGTCTCAAAAATTTGCCTGAACCCCCCTTGCCGTGCGTGCAGGAGTATATCGCGATGTTCCGCTGCATTCTGATCGATGACAATAGCAGCAACTT
CGGAAGCCATGGGGGTGTTATGCGTTCCAGGGTTCGCG