Description :
From Genome Similarity Track
Location :
Scaffold_308:21636- 25416
Transcript NameFunction/comments
Hyaar_Emoy2813668RabGAP/TBC domain-containing protein
Hyaar_Emoy2813669hypothetical protein

Sequence
3780 bases(100 bases per row)
AGCTTACCTTCACAATCCAGCGCTGCTGTAAAATTCCAGCCACATACCACATGCGCGATACGCGTTCCTTTCGGAAATTCCTGTATCGGATGAGGTGTGT
CTCGCCACCTATAATCACCCAGACCCAGACGACCGTTCCGTCCTCGACCAAACGTGAAGACAGTACCTTTCGTAGTAAGCACAGCCGTGTGCGCCCCACC
GCAACTAGCATTCACCACGCTCTCCCGCAGCAAGCTCATCACTTTGCGTGGCACAGCGCGGTCTCGCATGTCACCATGTCCAAGGCGCCCGTCTTCACCA
CTACCCCATGTATACAATTCTCCAGCGTCGGTGATGGCCAACGAATGCTGAGCACCGCATGCGATCGTTGCAATTGTCGTGCGATGAAGAGCTTTTTCTA
GCGCAAGCTCTTCGACGAGACGGGGTGCAAGGAACGACACAGTTACGCTGCTGCGAGCTGGTTCGCTGTCATTCGGATTATCCTTGATTGCCATAGTAAC
AGCTGCAGCTTTTTTATCTTCATTGTCACCGTAGCTGTATACGTCTCCTGTTGACGTCAGATAAAGCAGATGCTCGCCACCACAAGCCACTTGTAAAATT
GACTGTCCGTTTAGTAAAGATACTTTCTTTGGACGAAGAACAACCGGGGTCCCGCTTTCTAGACTAGGTGGCCGCCCCCACACCCACATGTGAGAACTTG
GCTCCTCAACATCCTGATCCACTATACTTTTATCCGCCTTCTCTACTTCTGCTTCACCTCCAGCTAATTCAACGTCGTCACTGTCATTGCAGCCTTCACC
TTCCATGCTTTCTCTACGCTTGCTTGCATCCACACTCATACCAGCGTCGTCAACTTCAACACTTGAAGCTACTGAATGTTCACCTGTAGCCAATAAATCA
TCAGCTCGAGCGGCTGCATCTATCGATACCTGTACCTGCATGATTTCCTCATAAAGACTCCCACTGCTCAAAACCGCACCACTTTCACCTATACCATGTA
CCTCCGTCGAAGACGCCTGTAAAGAACCAATATCACCTGAGCTTCCGCGTCCTAAATCCCTCTTTCTCGCTGCACATTCTGGCTGCAACTGGCTTTGATG
TCGAGACACGTGTTGTTCTTTTTCCAAGCCTTGAATAGCCGCCAGCATTTTTTTCTGAAGCTCAACGAACGCCTTCATACTCGTCTCTACATCCTCCCGT
AACTTAGTCGACAACGTCTCGCGCTCCTGTTCAAGCCGTCGAATTTGTGTCTCCTTCGCTAAACCTCCATGACTCCAGCTACTATGTCTCGTCCAGTACG
TGTGCTTCACCTCCGGCAGCATATCGTGACACAGTGTACTCAACGGCTTCAGCACTGCATCACACATTTGCTCAAACTCGGGCTGAACCGACGCCAGCAC
TTGAACCAGCGCTCTTACTAGTCGAGCAGCATGTGTCTCACTGTTATCCTCCTGTTCTCGATCCTGCTCATGGTTATTGTCAGAACTATTAAGAGGCTTC
ATCTCCCTCATCACTTCCGTCTTCTTCGTTTTTGCAGTGGCACAAAAAAGCGACATCTCAGTCACGCGCTTGTACTCATTTAGCACAGCAGCTGTCGCGT
CCCACCACGCAGTCGTTGACTGCTTATAAGCCCGTATACAGTGCCACAGTGCGTTCAAATTGCCTTCAGCCTGCAGCACGTCGTTCCGAAAACTCGTTGA
CACGACATCGTCACGCTGTCCCGCTTCCATTTGTGCTTCTTCCATACTGATTTGTACTCAATACCGAGCAGAGAGGAAGGGGTACGTCGCCTTCGTCTTC
GCTCGTCGCCACTCGCGTCCCTTGGCTTTCTGGTTCTGCTTGCGTCACTGGTACCCTTTTTAGTGGTACCTTGGCGGTCAATGGTACCGTTTTTAGTGGT
ACCATCGATGTGGGCCGGGTTGAATTTGGCAAGTCGCTCGTGGCGGGTTTCAGTGGTTACGATTCGATGTGAGAGCTATACAGAAACAGGGCATGTTCCG
CGCCGAGCTGTTGTCGGGTTGTTGCCTTGTCGCACATTGACGCAATACACAAGTACAACCATTTGCTGGAAACTCGTTGTGAGCGCATTGGAGCTCAGCT
ACCGATGGCGAGTTCACTTGTCGTGTCCACGCACGCGGCAGATCAACTGACGGCACAACGTGCAAATTGGCAGCAAGAGCACCAATGTCTACGTAGCAAC
GGTACACGAGAAAGGGCGGATTGCTGGAAGTCGAGACGTGCAGGACGTACGTTACAAAGGACTGGTGATCGCGTATAAGCTGGGCGCGGTAGCAACCGAG
CAGCTGCACGTCGATAGGCAGTTTGCAGCTGCCGGCCATTTTTGTTTACGGGATTACTCAATTGATTGACGACGAGCCGCGGTCGGTCGACTACCGGATT
CAGGATAGAAAGGACGTGGTCGGATGGCAATGCAAATTGCCACAAATTGTCAAAGTTGATACGTTTGCGGTTTCACAGGATATCCAACATTGCTTTGGCG
GTTCTAAAAATAACATCCAACACTCTTGGTCTGTGATGAACGACGAGCAGAGTGCGGAATGGACGTTGACGTTGCGGCAAGTGTTTCAGGACGTGCAGCT
CCAGGCCGTCGAGAGCAGTCGCTACGTCCGTCACGCATCAGGTGCCGCGCATCAGCAGACGCTTGTACCGGCCGTGCGCCGTCTCCAGACGCTCTTCCGC
GACGAAGTGAGCGACGGCAAGCGCCACGTGGTCGAAGAGTCGTTTGTCCTGTTTCTGGACGAGATGTGGGTAGGGGTTGTGAGAGTGATGGTCACGTCGA
AAGTCAGTGACGTTGTCGTGATCTCAATTGCATCACTCGTGGGCGCCTTTCTACACTGGCAACAGACCAAGAGCAATGCGTGGAAAGGCACGGCCGAGCT
GAGGGCCGAGCTGCTCAAGCGCCTGATGGACGCGACTGCAGCTGAAGATCGCGGCGTGCGGCTGCGCGCGTGTCACATGTTGCAGCTCGTCGTCAACTCG
CTGGATCTGGCAGACGAGGACGCAGATGTCGTGTCGCAGCTGCGACACGCGATGCTACGACGACTGCGGGACAAGTTGACGTCTGTTCGTATCCAGAGTA
TTTATGGGCTGAGGAAACTGCAGCAAAAACAAGTGGAAGGAGAGGGAGAGGAGACTGAAGACGAGGTGACTCGGGAGTTCCGGACGCTCATGGTGGCCGA
CCCTTCCAAGTGGGTGTTTTTTTTCTGTCCCTTTTATGCACTTGGTGCCATGTGTGTTTTTTAGTGGTCGCAAGAGATAGATGATGACTCATGGTTAACT
TGGTTGTTCTTTTTTTGTTTGCTTGTTCTTATAGAGAAGTTCGGAAGGCTGCACTGCTGAGTGTGACGATGAGCAAGACGACGTATCAGGACTTGCTCGT
CCGCATTCGCGACGCGAGCGAAGACGTGCGCTTTGCTGCGTTCCATACCATTGGCACGGAACTGCCGTTAGCGAAGATTCCGATCCACGATCGGGTCCAT
TTGCTGGATCAAGGTCTGCAAGACCGGGCGGCGCGTGTGAGACGGGCTTGTGAGCACATGGTACTTGACAAATGGTTCTTAGAGTGTGATTCGTCACCGA
TGGTGCTGCTCAAGGCATTGGAAATCGAGCAGTGTCCTAGTATTGGATCGAAGGTGTCGCATTTACTTTTGAAGCACTTTTCGGAGCAGCCGCAAGCGAT
GTTGGGAAATCAAGGCGTCGTCGAGTTTAACGCGTTGGAGTTGCTGTCGGAGAACAGTGACGCGTTTAATGCCGAGAGCA