Description :
From Genome Similarity Track
Location :
scaffold_83:21632- 27892
Transcript NameFunction/comments
g3060.t1hypothetical protein
g3061.t1hypothetical protein

Sequence
6260 bases(100 bases per row)
GCTGATGCTGACGCCCTCCTCTCTTGATGGCCTCCTTCCTGGCCTTCCACGTGCTCTCCTGTCCTCCGCGACGCATGGCCAGCTCCAGTTCCTGCTCCAG
ATCGTTGTTGCGAGCGTCGAACCGCTCCAGTTCAGCCAGGGCGATCCACTCGAACAGCGGCACGATGCTCAGAGCGCTCGGAGCCAAAAGAGTCGTAGCC
ACTTGTCTAGCGAACCTCACAGCGCTCTGAGGGGTGGGGAAACACTGGTAAACGTGCACTACGATGGCCTCAATGCACGTGGCTCCGGACGGTTGAAGAC
AGACGCTCACACACGCGAAGCGCTGGCCTGTGGCCTGCGGCAGGTCTGAAGCGCTGAACTGGGCGGCATTGGGGCTGGCCTCACCGGTGTCTAGAGCCAC
ACTGGGGAAGTTCTCCAGCGCCATCGTCATCTCGTCCTCCTTGTACACTGCGAAGCGGCTGCAGTCGCGGACGTCCGATATCCCTGCGGTTTTCTCTACT
GCGCAGATCTGGCGGAACAACCCCAGGGCATCCTCGATGTCTCGGAACTTGCCGAACACCCGGAAGTGGGTGAACTCTGGGTGGGAAGCAACGCTTGCAG
CTGCCACCGCTGCTTTACGGAGCTGATCCGCAGCAGACTTTGCTGATCTGGACGTTTTGCTCGCTGATAAGGACAACGAGATGCCTCTGGATGCCGGTCG
AGCGGCCTGTTCTTTCATGAATCCCAGCACGGCAAAAGGCTGACACACACCGTGGATGGGGTCCCAAATCGTGGCGGCAGTGGCAATTGCAGTCGTCGAC
GCCCCTGTGATACCGTTTTTTGCAGCGATGAGCGCATTGTCGAGCTTCTCCACTCGAACTCGTCCGCAACGACGCAACTCGCTGCGAAATTCCGTCGTTA
CTGCTGTGATCGGAGACGCCGTAGTCAGCAGTGCTCGGGTGCTCTTTTCTATATTGCTGCTGTCGGCCCGACGATTCAGTGTTTTACTACTACCAGAACG
CGCGAGGGCGAGTGGCAGTGAGGGAGTAGAGGTTGACTCGTCGTGCGGAACAGGGGGCAACTTCGCCCGACTTCCTCCATGCTGCAGTTTCGTGCTTGTT
AAATGCTCTTGCTGAAGAGACGACACTGAGGTGGATCGAGCCCCTGCTGCGTGGAGAGCTACAGTGCCAGCATTGTCTTGAGAATTACTTTTCGTTTCCT
CTGCAGTTATGGCGCTTTCTGGGGCTTCCTTGGGGCTTCCATTTGTTTGCTTCGCCTGCGTTCCAGATGCACTGATCTTCGACACTCCTCTTCGACGTTC
AAGCATGAGAGATCCAGGGTCAATCAGGACGCGAGCATCGTTCAGCGGCAGTAACGGAGCAGAGTGTGATTTGCCTAACAGCGTGGCTCCTTGATGGGTA
GAAATTGCACCTCGATCGGACCGTCCTCCAAAGGATCCAAACGCTTGGGGGTGACTTTCAGTCATGACACTACTGATGAACGCCTTCTTGTACTTTTCCC
ACGCGACAGATTTAAGTGCACGACTCTGGATGGACTCGCGGATGTATCCGTTCGAGGATCGCTGCAGACTCGCACGGGCTTCTGCCGACATGAGGTGGAA
AATATCAAACCGTGAAAGCACGAGGATTTTCATGGGTGATTCCGCCAAGATGGAGTACTCGCGAATGAAAATGTCGTTGAATCTCCCTGCTGATGCCCTG
TGAGCAGCAATACGTTAGCGGCAGTTTTTACACCCGAGGAATACTACAGTCAAGCCTTACTCTGCGCAGCCCAAGACCGAATTTGGTCCATATCTCCCCA
GCTCGTAGATCTGTCGTGCATTGGTGATCGGGTGCTTTCCTTCATTTATGATTCGGCATTCACCTCGAGTTACGATGAACAGTTCACTGGCTCGAGACCC
CTATTTACACGAAAACCTGTCAGTAAACCGAAGTCCGAAGACTTTCAGATGAGTTTCGACGTTACCTGCTTGCATATTTCACCTTTATACGGGATGTACT
TCTCCGTCATGACCGAACACATGCCTTCAATGGTGTTGTCATCCCACTCGGGACCGAGGAAATACGGGTTCTTTCTCAGCATCTGCGCGTACTGGGCGTG
ATACTCGTTCTGGTACTTCTGGATCAATGGCTCGTACTCATCGCGACCGAGGACAAGCAGCTCGCAGAACTCGGTGCACACAACGGTAGCGCGACGTACG
CCATCAGCCTGGGAAAGCGCTAATTCACCGAAATACTCGCCCTCCCCGAGCCTTGATACAACGCTTTCTTTCGTCTCCTCGAAACGATTCTTCGCGCGGA
CCGATACGTCCACGCAGCCCGTAAAAATGATGTAGAAATGTCTCCCCACTTGGCCTTCAGCGAAAAGCACAGTGTTCGTGACAGCACTAACAAGTCGCAT
AACATTGCACAGCTGCTTCCGGACTTCAAACGAAAACCGCGAAAAGAACTTGACACTCTTTAGATATTCGACAGCGAACTTCAAATCCTTCTCCGATCGT
TGGGCCGAGCTTCGCATGAAAATATTCCTCACAATATCCTTGTTGCTGCGGAAACGCTTGGTTATCTCGAGCGTGTTCGAGTTACTAGAGTCGTGTGACT
CCTTGAGGAGCTCGCTAAACACAACTCGATTGATGAATACAAGCTCCGTTGGTGCACTTAAAACAATCACGGATGCTACGAACAAATAAAAACTGAGCTA
ACGCTACCATCGAGTTCAGATAAGGAGGCTCTTACCAGCGCGTACATCTGTGTTGGAAAGCAATGCGCGCTCCCCAAAGGTATCTCCTGGTCCCAAAACA
ACTAAGCGAATGATCCCATTAACCCGAGTTGGGTCATTTTTAACCACGTCCACTGTACAAGACGTTAGTACAGAGGTCACGTGGGTAAGAACCTGCGAGC
CTACCTCGACCGGAGTAGACTAGGTAGAAGCTGTCTCCGTCGTCTCCCTAGAGAAAACAATAAGTTCGGTGTTCGATACATAGACTATTGCGAGGAAAAA
CAAACCTCGTGGAAGACATACGTTCCTTTGTCATTGTAGGCAACTATCTCAAGAGATTGATACAGTCGATCAAGCTAGAGCACCATCAGTCAAAATGGTG
CGCAGCAAGCTCAGTAAAGATACGAACGACATTCACCTTAACTAAACACAACGCGACAGAGCAAAGGGCGCGTTAGCTCAGACCCAGACAATAATTATCC
CATAGAGCGATACGCACAGGCGTCCAGATTAGTGAAGAATCCCAGCAGTTTGGACGACGCGAACAGCGATTTGAGCTGCACATTTGCAGCAACAAAAAAT
CAGACTCGAGAGCAGCAGCCACTGTGCGAGAAGCCAACCCACCACGTGGATATCCTCTAATGTGCGCTTCCCTGTCGCCTTGCGCAAGATGGTTCGACAC
ACGTTTATCTGCGGACTCTTGTGCTCGATGGCACGCAGGAAGGCGCCGTCGCTGGCCATCTCCTCCATCTGCGACGCCAGCGACCTGCGCCTCGACCCGC
TGCTCGCGTTCGCCACCACCACGTCCTCCTCTTCCTCCATTTTGACACAACAATTATGTGCTGATTCGCAGGACAGAAATAGCACACTTCAACATGAAAT
AGTCCAGCAATTGGTCAAGTTACGACCAGCTAGAAAACAAATTTACCTTGATTAAAGTAAGAACACCAAATTTGGTCCTTTCAGCATGACGAGGGAGACC
TCGTGGGTAGATGACGCTGTGCAGCGTCTGCGTCGGCACTTCGCCAGCGAGCGGTCTGTATCCGTGTACGAGTCTCTCACTGCGCATGTCCTAGACGCAG
CCACGGGCGGTGCGCTGTTCCTGGGGGGAGTTTCAGCGGCGCAAGTGGTGCAGAAGGTGCTGCGCGTCGGTTCTGCCTCTGGATTTCTGTTTCCTCAAGC
TCTGGGGGCTGCTGCAGTGGCTTCTTCCTCCGTCTTGGCGCTCCACTTCGCCTCCATCCCTCGGGAGGTTTACCAGGAGATTGCAGAGCAGAGTCGACGA
CGCTCCAGTGGCTGGAGTTGGCTCGTACTGGGGGCCAGGAACCTGCAGCCGCCCACAGCCTGGAAAGCTGCCCAAAAGAAGCTCCAGGAACGCTGGGAGG
ACCTCCCGCAAGCTCCGTATCCAGTGTATATGATAATGGGACTGCTGTGCTTCAAGCTGCTGGGAGGCCGCATGAGTGCATTGGCACCTTCGCCTTATTC
CAACTTGGGGGCTTTCCACCTTAAGAAGGCCTCACTGCCAGCTACAGCTGAGTACGCTACGAGTGTGGAGAGAGGAATTATCCAGGAGTTCGGGCGTCTC
TATGGTTGCCACACGTGTGGCATTAAACGGGGTGTGCGGTACCATGCAGACCACATGCCTCCTAAACTGTAGGCCGTAGCAGTACTGGTCCTAACTTGTG
TCTTTTATGCTGACTTAGCGTCTTGCTGTTTGGTATGTGTAGGGTGGCTAAACGCACTGATAACCAGTTCTTCAGAAAGATATTGGGACGACAGACCAGC
TTCCGCTTCTACCCGCAGTGCGAGTCGTGCTCCAACCAGCAGGGAAGCGTCGTGAAGCAGTGGAAATCCACGCTGAAGATGCATCTGCTGTCCTTCCGAG
CGTACCACTCGACAGGGCTGTGGCTCGTGCTACTCTGCACTGGCGGCCTCTACGTCGGAGGCTCGAGCTTCCATGAGACGTCGGAGGTGGCGGATACGTC
AGAGACTTCAGGTGCATTCACGTCCTCCGACTTTTCACTGCTGGTGGCTTTGCGTGAGAGGGAGCGGAAGTTACGCCGTGAACGAAGGAAAGCGAGCGAT
TCCAGTCAACGCGCTGCCATCGATAAAGAGTTGGAGGCGGTAGCCGAGTGCATGACAGCCATCAAAGCCGACATCAAACGGCAGGCGGCCAAGTAGTTAA
CAGCCTTTAACAAGCAAGCTTCGGACTGGTGAGTATCGGCTTTGGTGCTTTGAGGAGTTTCGAGCTATTTCCGTTGTGTTGATACTAGGACTCTTGAACG
CACCTACCGGTAGTCACTCGTGGAAGCGAACGGGGCTATGGCGGCAACCAAGCGAGAGTCTGCGGGGAAATCCTTTCTCGATCAACGTCACCCGAGGAAG
ACTGGCGTACGCAAACCGAACCATCCACAACGAGGCCACCGCCACCTCGTCACACTGTCTGAGGAGGAGATATCGAGGCGAGAGCAAGGCTGGAACGATC
GTTTTACTGTGGATCCACCGCCCAAATCCAACAAAGCTCTGTCACCTGCCAATTCTCCGACGTACAGCACTCCGCCAACTCCGCAAACGAAGGAGTCCAA
GATTCGTAACGAGCGCGCACAATATGGTTGGAGGATCGCTTCTTGTATAAACTCTGCGTTTCACTCACATTTCGTTCACGTGACAGGCAAACGTGGCGGA
AGACGAAGTCGTGAGCCAAAGAAGCCTTCAAGTGGAAAGCTGATACCTCTGGGCACTTTGTCAAAGCCCCCTTCAGTACGTTTCCGTCTGTTGGATTGAG
TTGCACCAGTTGCTGATAAAGTGCGATGTATATGTGCTTAAACACAGGAAGCAGCACAACCCACCAAAGAAGAAAAGCTGCGTTTCAAGGTCTTAAAAGC
GATCGACGCCCGGGAAACGCTGCTGTATCAGTTGAGCGCTCTGATTCTCTGCACACCAGCACAGGAGTCACTCTTCCTGCCGTCTAGACCTACGGAACCC
CCAACGTCGAACTCTGGAGGTCGACAACAGATGCGATCGAGGGGAGGAATGGCCCTTGCATCAACTCCATTGAGTCGACACGGCGGAGCGTCTGGTGCAA
TGACAAACGCTCGAGAGGCTACAAAACTAGCACAACAACTCGCCACAGACCTGCAGGTTACCGGGATTCAGTGTGTTGAAGCTTTGGTCGAATGGATGCT
AGAGGCTGGAGCGCAGGCAGAGTACGCGCTTTTGATCATCCTCCACGCACTACCGTTTCTAACTAATTGGTTCTTTTGTCCAGAACCCCTCCTCCATTCT
TGTGGCGGGGGCGCAACTACTTTCTGAAGATGTTTGGTGACTTGGATTTTGCAGAAGCAGAACTGCAGGCGAGAGGAGTCAACTTAGACTGCTTTAAGCA
GCACAACCCCCTTCTCATCAAGCCGAACCAGAAATTGGGTCGCGTGCTGGCTGCTCACTCTATCATCATGGAAATGATCGAGTTTGCGAAGGACATGACG
CCAATGGAACTGCTGGCACTGAGTGGACGCATGCGTAGCTCAAGTCGCGAGCAGACAGAG