Description :
From Genome Similarity Track
Location :
Scaffold_778:2163- 4525
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_778-snap-gene-0.5Conserved gene of unknown function

Sequence
2362 bases(100 bases per row)
TGGAGGAGTTGCGATGAATCGAGTTGTTGGAAATCTCGACGCGATGGGAGAGTATGATTCCTATGCACATGCGTAACAACCGAGACAGCCGAGCGACGTC
GCAGTTGCTGTTGGCAGGCGCAGCGACCGTTAAGGGCAAGCACATCTCCACTCAATGCGATAGTGCTGGTCCATCCATCAAAGTCGACCATCGAACAGGT
GATCGAACCCACTTTGGGCCGCAGTGGGTACGGCAAACGGAGTGTTGCGATAGGGAGCTGAACAACAAGTGTGCGGGTGAGTGCCGCTGAAACCCTGAAG
ACAGTTTGTGCTGCCGCGCAATCGGAGCGTGGCTAGTTACCACCATTCCGGTCGTTTGGGATCACCACGTCTCATGATGATTCGCAGGAATGCATGCGAT
TGCGCCGTCATTCCAGCGAAGTCAGCGCTTCAATAATCATCTTGAATGGGATATCCATTGATATGGGTGCATTGAATAGCCAACTAGAATCAACGCAAGC
AACTAACATCGCATATTGATATATACAGCATTTGCTGGTGTCTGCACCTCTCGAACTCCGCCCTCCATTTCATTCCGAAATTTGAACGACGCAAACCACT
CGTGCAAGCTACTACTGAATTTCAGCTCGCGCAACCCGCACCGCTCCACCATGCTCGCGCTCCGCACCGGTCGTCAGCTCGGTCTCCGCGCTGGAACCGC
GCTTGTCGCTCCTTCATCTGCACTGCTGCAGCCGTCGACGCATGGCGCTCGCAACTTCTGGTACGACGTGCGCAGCTCGGCGTCAAGGGAAGTCGCGAAG
CCAATCGCTGCCAATCAGAAGCTGGAGAAGACCTGGACGCTGACGGGCTCCAAGCCGCTCGACAAACTCAAGCTCTCGACTCCTGGACTGACCTTCATCT
CGATCGTGGACAACCGCACGCTCGCCGACGAGTTCGGGGTCGACCCGTCCCGCGCGGTGGCTTTTGTCCGAGCAACCAGCAACTCGAGTGAGGTGCTCGA
GCGGATCGAGGTAGATTCCAGGTTCGGCTACCGCACGCTCGTGGACTTTGACGTGCCCTTCCCATACGGCTCGACCAGTTCCGCCAACGATTTCTTGCTG
ACGGAGATATTGCTTCCGCCGACCTCGCTGCTCCGCAACATTGCCATCACCCAATTCGGCGACACGATCATTGACGGGTCGGCGCTGGCGACGGGCAAGC
GGTCGTTCAACGCAACCAAAATGGTGGTTAGCGGAGACCGACGCGTGTTCATCACATCTCAGGCAGAACAAGGGATCTTCTTTGGGAATCTACAGCTGGC
GACTGCCGTCGGCTCTCAAGTACACTTTCGAGCGCCTCGGGTCTCGGTGAAGAATAAGCTCAACGTCGCTGTAGCCGGCGGCAGCACCGTCACATTCGAC
AGCTCGGCGTTCCACGCCGACGTCGCTCGCCTGTTCGTCGCGGGAGGAGGAAATATCCACGTGAACGCCGAAAAGGTGTCGGTCGGGATGCTCCGCTCCT
GCATTGCCGGCGGCGGGAAGATCGCAGTGACTGCGGGTGAAGGCGAGGGTCGATGCGGCTGGCAACGCATCGACGTGGGAGGGTATGGCAACGTCGACAC
GTCCGACATTGAGTCCATTGAAGCCCGTGTTCGTGTGGCCGGTGATGGCGCTGTGACCGTTCGAGCGTCGGAGTACCTCGGCGTGCAAGCGTCAGGCCAC
GCCGCCGTCCGCTTCGTGCCGCCAGAGCCGCGCCTCGTTCAATGTCTGGCTATCCCCGACACCCTCCGCCCGCTCGACCCGAGCGAGCAAGCTGCTCGCC
CTGTTATCAGTTCCGTGACAGTGCCATCGAGAGCTGACGCGTTCGACGAAGCCAACAAGGTCGTGGTCGATCCGTCCTGGGTATGGAGGAGCCATTGGCA
CTGGAACAAATGGCACAAGCACTTGCCATACTGGGACGCTCACCGGTGGCACCGAGGCGGCCGACGACACTGGGGATGGCGAGGCTACAATCGCTACCGA
TACGATATGGCGGCAGCCGCCCCGTGGCATCAACAGCCCGCAGCGAAGCGCCACAAGGAAGAAGCGTGAAGAGTGCGATGCGCGACTTTTGAACGCCACG
TCACAGACTCGTTGGTAATGCCGTCACGGGCGTCATCAGTCCGACAATGCGACCATTTGAACCGGACATTGCTGACATACTGGTTTGCGCTGAATAGTAG
CGCGATCAGTTGGATCGTGGACGTCAAAAACCTCTAGTGTTGCATAGATGATTTTTGGTTCTGTTCGTAGCGAACCTTACGAGTTATCGCATGTACGCGG
TCATGTCTGCTGCTCTTTTCATACTAGCCGCGATCAGTGCCTGTCCTCGCGATGCTTGAATA