Description :
From Genome Similarity Track
Location :
Scaffold_3:21629- 26516
Transcript NameFunction/comments
g18679.t1hypothetical protein

Sequence
4887 bases(100 bases per row)
GGGATGATCGCTGGACACTGCGATCTCGACTTACTTCTGGATCCCTTCTTCCTTCACTTTCCGCGCCAAACGAAAGGAGCTTTTGGTACCCCGGCCTCGG
AGCCACGCGGGCGCCCCCTGACTTGATCAACGCTCTTCCTACCGCAGATTCTGCCGACCCGTGGCGCAACCAATATCGCACACAACTGGGCGATCAACCC
GGGTCCCGCATCGCACGCTTGGATGGTAAGTTTCGGTCTGTCGTCAACTCTGAGTGAAGTAACCCTCTCCGAGGTCTTGATAAGCTTCTGCAATACATTC
TTTCTCCTCTCTTTCCCTCTTTATTGGGTCGCCCAACCCCGATCGGCATCTTCCTCACCCGATCGCAAACTCACACACCACAAATTACCCCTTCCTCCGA
TGTGCGGCCATCCCGCACATCCTTCATTATCCTCCTCCCCTACAGTGCCTGTTACTGCAGGGGGGTTTCCGCTTCCTCTTGCTGGGACTGCATCGCTTTG
AATCTGTTCCGGCTGGCCAGTCCTCGTTCAAAATCGCGCAACATAGCGCCGCAATTAAGGTCCGCCTCATCGACCCAAGTTGGATCGTCGTAGCCCTTCC
AGAACACCAGAAAATCTCGGTGGACTCGTCCATAGCGCGTCCGGCGGCCGGTTCTCACATCCGCGATCTTCTCCACTTCAAACTCGCCTTCGTCGAGTGG
GGTCTCCCAGCTGTCTTCCGGCAGGAGGGCTTCATCAAAGTCCAGGCGATCGCTCTCGGTCACAAGCAACGACGTGTCAGGACGATCGGGGAACCTCCGG
ACCAACTTCAATTTGGACACATGCACGATCTGGAAGATCCTATACTCCGAACCCGCGATCTCAAGACGTGCGGCGTGATCGCCGATCATCTCAGCAACAC
GAAAAGGTCCATGCCACAGGTGTGCAAGCTTTCGTGCGTACCCCTCCTTAACTCGGTCGAGGTGCAGCCACACTTGAGCGCCTGCCGCGATGTTGTGGGG
CCGCAGATCTTCGTTGTGTCGGTTGGCTCTGCCTCTGATCGCTTCGCGCAGTCGCTCGCGGACCTGTTCACGCGCTCGCTGGTAGTGTTCCTGTACGTGG
TACCTCCATCGACGAGGCTCCTGATCGCGTCGGCGCGTGCTGCCTAACGGTAGCGCCGCCTCCAGCGTCGATCACGGTCCCACCCGTGGACCAGGTAGAA
CGGCATGTCACCACGAACTCGATCCTGGACAGTATTTAGGGCGAACGTGAGTCGCTCCGCGTACTCGTCCCAGTCTCTCTGGTTCACGTCTGACACGTAC
ATCTTCAGCGATCGCGTTAGAGTCTGCACCATTCGTTCGGCAGTTCCGTTGGCTTGCGGCCGGTACGCCATCGTAGCTCTCTGTTTCTGACCCACTATCC
GGCTAAAAGCACGGAAGAAATCTGACATAAAACCGGGCTCTCGATCATGGCGGATGACCTCACTGGCGCCGAAGCGCCGAAAGACGCATTCCTCGTAGTT
CTCGGTGATCGTCTGGGCAGTGCGAGAGGCGCTTGCCTTCGCGATCACGTATCCGGTGAAAAGGTCGACCCAGATTAACAGCTCTGTGTTCCCTTTGTAT
GACTTCGGTAGAGACAGACCATGGTCCATGGCAATCATTTGGAATGGGTACGTAGCTTGTACATTCCCAGGCGACTCTCCCTGAATGAGGGGGCGCCCTT
TCCCAGTTTCACAACCCACACATTCTCCCACGAACCGCTGAACACTCCTGAACAGCTCTCTCCAGTGGATAGCGCCTTGACACGCTGGTAAGTCCTCCCG
ATCCCTTGGTGCCCGCCTTCCAGGCTAGCGTGGTAATGATGCAGAACGTCTTGTTGTAGCGTCTCCGGGATGACCAGCCGCGCGAGGGAGTCTCGATCTT
TGTCCGATTGCGGTTTTGTCGGGCAGTACAGCAGGAGCCCGCTCTCGTCCAGCTCGTAATCGCAAGCGGTCTTGGCGCAGGACTTAGCGTCGCTCGACGA
CAGGTCAGTCACTTCGCCCCGCACGTACGATTTCATGTTCGCGATCCACTGCTCTTCGTCTTGGGGTTGCGTGATCCGTTCACTCCTGATGCGTTGCACG
ATTGCTTCTTGCAGAACTTCCGGCGTTCGTCTCGACCGTCGTGCCGATCGCGTCACTGCTGATACACGAGCTACAGCGTTATCATCCTTCGGCTTCAGGA
GCTCGTCCAGCCGATTGAGTGTGATCAGGTCCTGCCGATCAACTTCCGAGGTAACCACGGTTCCTTCGCCCCGTTGAAGAGCTTCGCTAGCTAACTTGTC
CGCGCTCTGGTTCCAATCTCGTTTCATATGTAAGAACTCGTGTCTTGGCCACGATCGGAGCCGATCCATCGCATTCTCGCGCAATAACAACAGGCCAGGG
GCCTTGCATGCGATCTCACCACGCATTTGCCGGATCACTAAATTGGAGTCGCCGCAGATCACGACCCGCCCCCTGTCCATAGTGGACAGGAGATCGAAAC
ACAGCAACAGTCCGCGGTATTCAGCTTCGTTCACCGTCAGATCAGACATATACTCCGATGCGGCCGTGACGATCGTCCATTCCGGCAGCTTCCACACGAT
CGCGCTATAAGCGCCACCATTGCGTTTGACACGCGCTGATCCGTCGAAACTCGCGACCAGCAAGGTTTCATCCGCCTTGACCGTAGGGGGTGGCATGGTG
ATCGTCTGTCGGGCCTGCTTCACTGGCGCAAGCGCGATCAACGCCTCGTCTACTTCCGCGCGAGGCGTGATACTTGCTGCGATCACACCCAGAATTTCGT
CCTCCTCTTTCGTGCATTTCCTGATCTCTAGCGTCCATTCTGACAGCAAGGCCGCCCAATTACCTAGTCTCCCCTGGAAACCAGCCGAGTTGACCAACCA
AGCCAGCGTCGAATGTCTGGACAGCACCAAGATCGATCTCGTCGTCAACAGGGTGTAATTCACGTCCAGTATCCGCAGGAGTGCCAAGACTTCCTTGTCG
ACAATCCCGTAGTTGATCTCGTTGGGTTTCAGAGTACGACTGGTGAAGGTTACTGGCCAGTACACGCCATCATGCTCTTGTACGAGTGCCGTGGAGATCG
CCCACTGGCTCGCATAGACTACGATCACCGGGGTGCGATCTGGATCGAAATGTTTCAGTACCGGAGTGGACACGATCTTGGCCTTCAGCATCGTGAATGC
GACCTTCGCTCGGGCCCAGCGGTCAGCATCTTCTGCTCGCGTGACAACGCCCCCAGCTACTTGTTCGCTGGGGATGGACCTGTCCTGTTGACCTATCTTG
TGGAAGTCCGCTTCGCGCAGCTCGTATAAGACAGCGGCATAGACCGCGAAGTCTTCGATGAAACGACTGTAGTAGTTCAAACTTCCAAGGAAGGACTGCA
TCGATCGCAGAGTCTGCGGGAAGGGAAGGTTGCCTAACACTTCAAGGTCTTTCGGATGGGCTTCCAAACCGTCGACGGACACTCGGTGTCCCAAGTAGTC
TACTTTTCGTCGGCCCCAGAAACTTTTGACCACACTGATGGACAAATTCCATCGTTCGCAAGCATCGAGCAGTGCTTCAACCTTCTCACACAGCATGTCC
CAAGTGATCGCAGTCACCAGAATATCATCGATGTACGATCGCCTTCCCAACACTGACGGTCTCGGCTCTGGTTCTGGCTCGCCTGAATCGAACACGTCGA
TCGGTTTCGACGGATCGTGACCGGCGCGGATTCGGAAGTGTCCATACAGCGCGTTATCAATCAATCGCTGGTAGATCTGTGGCGCATTCTTCAACCCGAA
AGGCATACGCGTCCACTCGAACAACCCGAACGGTGTGATGAACGCAGAGATCCTCCGTGCGCGTTCTGTCATGGAGACTACCCAGAAGCCACTTGCCATA
TCGAGTGAGCAATACCAGAGCACTTTGTCCAAGTCTTCCAAGAGATCGCTAATCAGCGGCATGGGGTACACCATCAGTCTCGTCAAACTATTCACCAGCC
TGTAGTCGATACAGAGCCGGATGTCAACGCCGTTCTTCTTGATGATGATTACGATCGGAGAGGCCCACGGTGAAGTTGACGGCGTGATCATCTTCGCCGA
TAACAGGCTCTTGATCAGATCCGACAGCTTCTCACGGAACTGTGGAGCGACTTTTCGGGCACGTTGTGCAACAGGAGCTGCTCCTCCCACATCGATGTCG
CAGACTGCGCCAACGGCAGCTGGTGGTAACGCGTTTCCTTTCCCGATCAGGAGATGTTTCCGCCTCCAAATTATCTGTCGCAGGCGATCCATTTCTTCCG
GGGTGTTTGACTCAGGATCGCCCACCTGGATATCCTCGATCGTGACTTCATCGGTGGTGGTCACTACTTCCGGCAAGATTGCCATCTGTCTCTCCACATC
TTCCGCGAACAGGTCGCCACCTTCGTGGTAACATACTTCTTCGTCATCCAGCGGTTCCGGATCAACGATCGGAGGCGTTTCGGCCTGGGGCAAAGACTCC
TTCCGGTCAGCAGTCATCTCACTTCGTGTGGCCTGCTCCATTGGCGGAGATTCTCTCGCGTCCTGATCGCCGGTGCCACCTTCCTGATCCCTTGGAGACC
CCACAGCTTCTGATTTCATCTCGGCGGGTCGAGGCACGGTTAGTTGTGCGACGACCGATCTCGAGGTTCCGCGGTCACGACGCAGGATTTTCATCGGTGT
GTCGTACTGAGGTCGATCTACCATGGGTCCGGTAGGGGCGAGTTCATGCTCTTCTACCTCCACACGGTCTGTAGTGAACTGGAAAGCTAGATTCTGCCAC
TCGGCATACCTGCGCGATCCAAGTAACACGAAACCGGGAGTGCGAGGTACGCGTCCCCCTTCGAGCCACATGCCGACGTGGGTGTCA